BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30510

Title: Solution structure of HIV-1 TAR with Tat RNA Binding Domain   PubMed: 30323330

Authors: Pham, V.; D'Souza, V.

Citation: Pham, V.; Salguero, C.; Khan, S.; Meagher, J.; Brown, W.; Humbert, N.; de Rocquigny, H.; Smith, J.; D'Souza, V.. "HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry"  Nat. Commun. 9, 4266-4266 (2018).

Assembly members:
entity_1, polymer, 30 residues, 9652.762 Da.
entity_2, polymer, 17 residues, 2162.533 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGCAGAUUGAGCCUGGGAG CUCUCUGCCC
entity_2: GISYGRKKRRQRRRAHQ

Data sets:
Data typeCount
13C chemical shifts120
15N chemical shifts20
1H chemical shifts307

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 30 residues - 9652.762 Da.

1   GGGCAGAUUG
2   AGCCUGGGAG
3   CUCUCUGCCC

Entity 2, entity_2 17 residues - 2162.533 Da.

1   GLYILESERTYRGLYARGLYSLYSARGARG
2   GLNARGARGARGALAHISGLN

Samples:

sample_1: TAR RNA 0.5 ± 0.1 mM; Tat RNA Binding Domain 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM

sample_2: TAR RNA, [U-13C; U-15N], 0.5 ± 0.1 mM; Tat RNA Binding Domain 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM

sample_3: TAR RNA 0.5 ± 0.1 mM; Tat RNA Binding Domain 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM

sample_4: TAR RNA 0.5 ± 0.1 mM; Tat RNA Binding Domain, [U-13C; U-15N], 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM

sample_conditions_1: ionic strength: 80 mM; pH: 5.4; pressure: 100000 Pa; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
2D 1H-13C HSQCsample_4anisotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection

NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking

CYANA, Guntert, Mumenthaler and Wuthrich - data analysis, processing, structure calculation

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement

NMR spectrometers:

  • Bruker DMX 700 MHz

Related Database Links: