BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30452

Title: Solution structure of a ultra-high affinity macrocycle bound to HIV-1 TAR RNA   PubMed: 30481318

Authors: Shortridge, M.; Varani, G.

Citation: Shortridge, M.; Wille, P.; Jones, A.; Davidson, A.; Bogdanovic, J.; Arts, E.; Karn, J.; Robinson, J.; Varani, G.. "An ultra-high affinity ligand of HIV-1 TAR reveals the RNA structure recognized by P-TEFb"  Nucleic Acids Res. 47, 1523-1531 (2019).

Assembly members:
entity_1, polymer, 14 residues, 1697.087 Da.
entity_2, polymer, 29 residues, 9307.555 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology   Host organism: synthetic construct

Entity Sequences (FASTA):
entity_1: XVRTRKGRRIXIXP
entity_2: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC

Data sets:
Data typeCount
13C chemical shifts171
15N chemical shifts11
1H chemical shifts338

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 14 residues - 1697.087 Da.

1   DABVALARGTHRARGLYSGLYARGARGILE
2   4J5ILEDPRPRO

Entity 2, entity_2 29 residues - 9307.555 Da.

1   GGCAGAUCUG
2   AGCCUGGGAG
3   CUCUCUGCC

Samples:

sample_1: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.7 mM; RNA (29-MER) 1.2 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM

sample_2: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.7 mM; RNA (29-MER) 1.2 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM

sample_3: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.5 mM; RNA (29-MER), [U-99% 13C; U-99% 15N], 1.0 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM

sample_4: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.5 mM; RNA (29-MER), [U-99% 13C; U-99% 15N], 1.0 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM

sample_conditions_1: ionic strength: 30 mM; pH: 6.5; pressure: 1 atm; temperature: 277 K

sample_conditions_2: ionic strength: 30 mM; pH: 6.5; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_4isotropicsample_conditions_2
3D 1H-15N NOESYsample_3isotropicsample_conditions_1
3D 1H-13C NOESYsample_4isotropicsample_conditions_2

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

SPARKY, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker AvanceII 600 MHz
  • Bruker AvanceIII 800 MHz

Related Database Links: