BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30261

Title: HnRNP A1 Alters the Conformation of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation   PubMed: 28625847

Authors: Tolbert, M.; Morgan, C.; Tolbert, B.

Citation: Tolbert, M.; Morgan, C.; Pollum, M.; Crespo-Hernandez, C.; Li, M.; Brewer, G.; Tolbert, B.. "HnRNP A1 Alters the Structure of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation."  J. Mol. Biol. 429, 2841-2858 (2017).

Assembly members:
entity_1, polymer, 41 residues, 13140.855 Da.

Natural source:   Common Name: Enterovirus A71   Taxonomy ID: 39054   Superkingdom: Viruses   Kingdom: not available   Genus/species: Enterovirus A71

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGAUCAAUAGCAGGUGUGGC ACACCAGUCAUACCUUGAUC C

Data sets:
Data typeCount
1H chemical shifts131

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 41 residues - 13140.855 Da.

1   GGAUCAAUAG
2   CAGGUGUGGC
3   ACACCAGUCA
4   UACCUUGAUC
5   C

Samples:

sample_4: rNTP, [U-13C]-Gua, 300.0 uM

sample_1: rNTP, Selective Deuteration; EQUIMOLAR MIX:ATP, GTP, CTP, UTP, 180.0 ± 0.2 uM

sample_2: rNTP, Fully protonated, 300.0 ± 0.2 uM

sample_3: rNTP, Fully protonated, 100.0 uM

sample_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 .; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HMQCsample_4isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1

Software:

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRView, Johnson, One Moon Scientific - chemical shift assignment

TOPSPIN, Bruker Biospin - collection

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker Avance 800 MHz

Related Database Links: