BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30132

Title: Solution structure of P2a-J2a/b-P2b of medaka telomerase RNA   PubMed: 27531956

Authors: Wang, Y.; Feigon, J.

Citation: Wang, Y.; Yesselman, J.; Zhang, Q.; Kang, M.; Feigon, J.. "Structural conservation in the template/pseudoknot domain of vertebrate telomerase RNA from teleost fish to human"  Proc. Natl. Acad. Sci. U. S. A. 113, E5125-E5134 (2016).

Assembly members:
entity_1, polymer, 36 residues, 11464.795 Da.

Natural source:   Common Name: Japanese medaka   Taxonomy ID: 8090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Oryzias latipes

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGUGUACUUAACGUUUGCU UCGGCAAACUACAUCC

Data sets:
Data typeCount
13C chemical shifts206
15N chemical shifts37
1H chemical shifts272

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 36 residues - 11464.795 Da.

1   GGGUGUACUU
2   AACGUUUGCU
3   UCGGCAAACU
4   ACAUCC

Samples:

sample_2: Telomerase RNA P2ab, [U-13C; U-15N], 1.0 mM; potassium chloride 100 mM; sodium phosphate 10 mM

sample_3: Telomerase RNA P2ab 1.0 mM; potassium chloride 100 mM; sodium phosphate 10 mM

sample_4: Telomerase RNA P2ab 1.0 mM; potassium chloride 100 mM; sodium phosphate 10 mM

sample_5: Telomerase RNA P2ab, [U-13C; U-15N], 1.0 mM; potassium chloride 100 mM; sodium phosphate 10 mM

sample_conditions_1: ionic strength: 100 mM; pH: 6.4; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 100 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H TOCSYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_4isotropicsample_conditions_2
2D 1H-1H TOCSYsample_4isotropicsample_conditions_2
2D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-13C HSQCsample_5isotropicsample_conditions_2
3D HCCH-TOCSYsample_2isotropicsample_conditions_1
2D filtered/edited NOESYsample_2isotropicsample_conditions_2
2D DQF-COSYsample_3isotropicsample_conditions_1
JNN-COSYsample_3isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment, peak picking

TOPSPIN, Bruker Biospin - collection, processing

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

X-PLOR NIH v2.42, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker DRX 600 MHz
  • Bruker DMX 500 MHz

Related Database Links: