BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30108

Title: Solution structures of the apo state fluoride riboswitch

Authors: Zhang, Q.; Zhao, B.

Citation: Zhang, Q.; Zhao, B.. "Solution structures of the apo state fluoride riboswitch"  . ., .-..

Assembly members:
riboswitch (47-MER), polymer, 47 residues, 15053.960 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
riboswitch (47-MER): GGCGAUGGUGUUCGCCAUAA ACGCUCUUCGGAGCUAAUGA CACCUAC

Data sets:
Data typeCount
13C chemical shifts240
15N chemical shifts19
1H chemical shifts289

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 47 residues - 15053.960 Da.

1   GGCGAUGGUG
2   UUCGCCAUAA
3   ACGCUCUUCG
4   GAGCUAAUGA
5   CACCUAC

Samples:

sample_1: EDTA 50 uM; RNA (47mer) 1.0 mM; magnesium chloride 10 mM; potassium chloride 50 mM; sodium phosphate 10 mM; H2O 95%; D2O 5%

sample_2: EDTA 50 uM; RNA (47mer) 1.0 mM; magnesium chloride 10 mM; potassium chloride 50 mM; sodium phosphate 10 mM; D2O 100%

sample_3: EDTA 50 uM; RNA (47mer), [U-100% 13C; U-100% 15N], 1.0 mM; magnesium chloride 10 mM; potassium chloride 50 mM; sodium phosphate 10 mM; H2O 95%; D2O 5%

sample_4: EDTA 50 uM; RNA (47mer), [U-100% 13C; U-100% 15N], 1.0 mM; magnesium chloride 10 mM; potassium chloride 50 mM; sodium phosphate 10 mM; D2O 100%

sample_5: EDTA 50 uM; RNA (47mer), [U-13C; U-15N]-Gua, 1.0 mM; magnesium chloride 10 mM; potassium chloride 50 mM; sodium phosphate 10 mM; D2O 100%

sample_6: EDTA 50 uM; RNA (47mer), [U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura, 1.0 mM; magnesium chloride 10 mM; potassium chloride 50 mM; sodium phosphate 10 mM; D2O 100%

sample_conditions_1: ionic strength: 80 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K

sample_conditions_2: ionic strength: 80 mM; pH: 6.4; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_2
2D 1H-13C HSQCsample_3isotropicsample_conditions_2
2D 1H-13C HSQCsample_5isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
2D HCCH COSYsample_5isotropicsample_conditions_1
2D 1H-13C HSQCsample_6isotropicsample_conditions_1
2D HCCH COSYsample_6isotropicsample_conditions_1
31P spin-echosample_6isotropicsample_conditions_1
31P spin-echosample_5isotropicsample_conditions_1
3D HCCH-TOCSYsample_6isotropicsample_conditions_1
3D HCCH-TOCSYsample_5isotropicsample_conditions_1
2D 1H-13C HSQCsample_3anisotropicsample_conditions_1
CH-HCCH spin-echosample_5isotropicsample_conditions_1
2D 1H-15N HSQCsample_3anisotropicsample_conditions_1
CH-HCCH spin-echosample_6isotropicsample_conditions_1

Software:

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing

SPARKY v3.110, Goddard - chemical shift assignment, data analysis, peak picking

TOPSPIN v3.2, Bruker Biospin - collection, data analysis, processing

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

NMR spectrometers:

  • Bruker AvanceIII 600 MHz
  • Bruker AvanceIII 500 MHz

Related Database Links: