BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30049

Title: Excited state (Bound-like) sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat   PubMed: 7286828

Authors: Borkar, A.; Bardaro, M.; Varani, G.; Vendrucolo, M.

Citation: Borkar, A.; Bardaro, M.; Camilloni, C.; Aprile, F.; Varani, G.; Vendrucolo, M.. "Structure of a low-population binding intermediate in protein-RNA recognition"  Proc. Natl. Acad. Sci. U. S. A. 113, 7171-7176 (2016).

Assembly members:
Cyclic peptide mimetic of Tat, polymer, 14 residues, 1768.189 Da.
Apical region (29mer) of the HIV-1 TAR RNA element, polymer, 29 residues, 9307.555 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Cyclic peptide mimetic of Tat: RVRTRKGRRIRIXP
Apical region (29mer) of the HIV-1 TAR RNA element: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC

Data sets:
Data typeCount
13C chemical shifts162
1H chemical shifts389

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 14 residues - 1768.189 Da.

1   ARGVALARGTHRARGLYSGLYARGARGILE
2   ARGILEDPRPRO

Entity 2, entity_2 29 residues - 9307.555 Da.

1   GGCAGAUCUG
2   AGCCUGGGAG
3   CUCUCUGCC

Samples:

sample_1: RNA and peptide, [U-99% 13C; U-99% 15N], 2 uM; D2O 100%

sample_conditions_1: ionic strength: 150 mM; pH: 6.6; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
RDCsample_1anisotropicsample_conditions_1

Software:

Gromacs and Plumed, Vendruscolo, Camilloni and Borkar - structure calculation

NMR spectrometers:

  • Varian INOVA 800 MHz

Related Database Links: