BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30026

Title: NMR structure of the 5'-terminal hairpin of the 7SK snRNA   PubMed: 27852926

Authors: Bourbigot, S.; Dock-Bregeon, A.C.; Coutant, J.; Kieffer, B.; Lebars, I.

Citation: Bourbigot, S.; Dock-Bregeon, A.C.; Eberling, P.; Coutant, J.; Kieffer, B.; Lebars, I.. "Solution structure of the 5'-terminal hairpin of the 7SK small nuclear RNA"  RNA 22, 1844-1858 (2016).

Assembly members:
RNA (57-MER), polymer, 57 residues, 18268.777 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
RNA (57-MER): GGGAUCUGUCACCCCAUUGA UCGCCUUCGGGCUGAUCUGG CUGGCUAGGCGGGUCCC

Data sets:
Data typeCount
13C chemical shifts68
15N chemical shifts23
1H chemical shifts256

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 57 residues - 18268.777 Da.

1   GGGAUCUGUC
2   ACCCCAUUGA
3   UCGCCUUCGG
4   GCUGAUCUGG
5   CUGGCUAGGC
6   GGGUCCC

Samples:

sample_1: HPI 0.8 mM; HPI, [U-99% 13C; U-99% 15N], 0.4 mM; HPI, [U-13C; U-15N]-Ade, 0.4 mM; HPI, [U-13C; U-15N]-Cyt, 0.4 mM; HPI, [U-13C; U-15N]-Gua, 0.4 mM; HPI, [U-13C; U-15N]-Ura, 0.4 mM; H2O 90%; D2O 10%

sample_2: HPI 0.8 mM; HPI, [U-99% 13C; U-99% 15N], 0.4 mM; HPI, [U-13C; U-15N]-Ade, 0.4 mM; HPI, [U-13C; U-15N]-Cyt, 0.4 mM; HPI, [U-13C; U-15N]-Gua, 0.4 mM; HPI, [U-13C; U-15N]-Ura, 0.4 mM; D2O 100%

sample_3: HPI, [U-13C; U-15N]-Ade, 0.4 mM; HPI, [U-13C; U-15N]-Gua, 0.4 mM; HPI, [U-13C; U-15N]-Ura, 0.4 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 50 mM; pH: 6.4; pressure: 101325 Pa; temperature: 288 K

sample_conditions_2: ionic strength: 50 mM; pH: 6.4; pressure: 101325 Pa; temperature: 303 K

sample_conditions_3: ionic strength: 50 mM; pH: 6.4; pressure: 101325 Pa; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_3anisotropicsample_conditions_3
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D DQF-COSYsample_2isotropicsample_conditions_2
3D HCCH-TOCSYsample_2isotropicsample_conditions_2
2D 1H-15N HSQCsample_3anisotropicsample_conditions_3
3D HCPsample_2isotropicsample_conditions_2
2D HPCOSYsample_2isotropicsample_conditions_2
2D HCNsample_2isotropicsample_conditions_2

Software:

CNS, Brunger A. T. et.al., Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure calculation

SPARKY, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker AvanceIII 500 MHz
  • Bruker AvanceIII 700 MHz
  • Bruker DRX 600 MHz

Related Database Links: