BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27794

Title: 1H, 13C, and 15N chemical shift assignments of the GTP 9-12 RNA aptamer in complex with GTP   PubMed: 31030336

Authors: Wolter, Antje; Pianu, Angela; Kremser, Johannes; Strebitzer, Elisabeth; Kreutz, Christoph; Duchardt-Ferner, Elke; Woehnert, Jens

Citation: Wolter, Antje; Pianu, Angela; Kremser, Johannes; Strebitzer, Elisabeth; Schnieders, Robbin; Fuertig, Boris; Kreutz, Christoph; Duchardt-Ferner, Elke; Woehnert, Jens. "NMR resonance assignments for the GTP-binding RNA aptamer 9-12 in complex with GTP"  Biomol. NMR Assignments ., .-. (2019).

Assembly members:
GTP_9-12_aptamer, polymer, 39 residues, Formula weight is not available
entity_GTP, non-polymer, 523.180 Da.
entity_MG, non-polymer, 24.305 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: in vitro transcription   Host organism: Escherichia coli, cell free

Entity Sequences (FASTA):
GTP_9-12_aptamer: GGGAGCAGUUCAGGUAACCA CGUAAGAUACGGUGCUCCC

Data sets:
Data typeCount
13C chemical shifts324
15N chemical shifts146
1H chemical shifts351

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1
2ligand2
3Mg3

Entities:

Entity 1, RNA 39 residues - Formula weight is not available

1   GGGAGCAGUU
2   CAGGUAACCA
3   CGUAAGAUAC
4   GGUGCUCCC

Entity 2, ligand - C10 H16 N5 O14 P3 - 523.180 Da.

1   GTP

Entity 3, Mg - Mg - 24.305 Da.

1   MG

Samples:

unlabeled_H2O: GTP 9-12 aptamer 0.86 mM; nucleoside triphosphate GTP 1.29 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; H2O 95%; D2O 5%

unlabeled_GTP-13C15N_H2O: GTP 9-12 aptamer 0.86 mM; nucleoside triphosphate GTP, [U-13C; U-15N], 1.29 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; H2O 95%; D2O 5%

unlabeled_GTP-13C15N_D2O: GTP 9-12 aptamer 0.86 mM; nucleoside triphosphate GTP, [U-13C; U-15N], 1.29 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 100%

15N_H2O: GTP 9-12 aptamer, [U-15N], 1.035 mM; nucleoside triphosphate GTP, [U-15N], 1.55 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 5%; H2O 95%

13C15N-A-C_H2O: GTP 9-12 aptamer, [U-13C; U-15N]-Ade/Cyt, 1.24 mM; nucleoside triphosphate GTP 1.86 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 5%; H2O 95%

13C15N-A-C_D2O: GTP 9-12 aptamer, [U-13C; U-15N]-Ade/Cyt, 1.24 mM; nucleoside triphosphate GTP 1.86 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 100%

13C15N-G-U_H2O: GTP 9-12 aptamer, [U-13C; U-15N]-Ade/Cyt, 1.13 mM; nucleoside triphosphate GTP 1.7 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 5%; H2O 95%

13C15N-G-U_D2O: GTP 9-12 aptamer, [U-13C; U-15N]-Ade/Cyt, 1.13 mM; nucleoside triphosphate GTP 1.7 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 100%

13C15N_H2O: GTP 9-12 aptamer, [U-13C; U-15N], 0.67 mM; nucleoside triphosphate GTP 1.34 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 5%; H2O 95%

sel_2H_H2O: GTP 9-12 aptamer, [U-2H], 1 mM; nucleoside triphosphate GTP, [U-2H], 1.5 mM; magnesium acetate 2.5 mM; potassium chloride 25 mM; potassium phosphate 25 mM; D2O 5%; H2O 95%

sample_conditions_1: ionic strength: 50 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

sample_conditions_2: ionic strength: 50 mM; pH: 6.3; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQC15N_H2Oisotropicsample_conditions_1
2D 1H-15N HSQC13C15N-G-U_H2Oisotropicsample_conditions_1
2D 1H-15N HSQC NH2 only15N_H2Oisotropicsample_conditions_1
2D 1H-15N HSQC NH2 only13C15N-A-C_H2Oisotropicsample_conditions_1
2D 1H-15N HSQC NH2 only13C15N-G-U_H2Oisotropicsample_conditions_1
2D 1H-13C HSQC aromatic13C15N_H2Oisotropicsample_conditions_1
2D 1H-13C HSQC aromatic13C15N-A-C_D2Oisotropicsample_conditions_1
2D 1H-13C HSQC aromatic13C15N-G-U_H2Oisotropicsample_conditions_1
2D 1H-13C HSQC aliphatic13C15N-A-C_D2Oisotropicsample_conditions_1
2D 1H-13C HSQC aliphatic13C15N-G-U_D2Oisotropicsample_conditions_1
3D HCCH-TOCSY13C15N-A-C_D2Oisotropicsample_conditions_1
3D HCCH-TOCSY13C15N-G-U_D2Oisotropicsample_conditions_1
3D HCCH-COSY13C15N-A-C_D2Oisotropicsample_conditions_1
3D HCCH-COSY13C15N-G-U_D2Oisotropicsample_conditions_1
2D 1H-1H NOESYunlabeled_H2Oisotropicsample_conditions_1
2D 1H-1H NOESYsel_2H_H2Oisotropicsample_conditions_2
3D 1H-13C NOESY aromatic13C15N-A-C_H2Oisotropicsample_conditions_1
3D 1H-13C NOESY aromatic13C15N-G-U_H2Oisotropicsample_conditions_1
3D 1H-13C NOESY aliphatic13C15N-A-C_D2Oisotropicsample_conditions_1
3D 1H-13C NOESY aliphatic13C15N-G-U_D2Oisotropicsample_conditions_1
3D 1H-15N NOESY15N_H2Oisotropicsample_conditions_1
2D 1H-13C H(N)CO13C15N-G-U_H2Oisotropicsample_conditions_1
HNN-COSY15N_H2Oisotropicsample_conditions_1
SELLR HNN-COSY15N_H2Oisotropicsample_conditions_1
amino HNN-COSY15N_H2Oisotropicsample_conditions_1
2D lr-1H-13C-HSQC13C15N-G-U_H2Oisotropicsample_conditions_1
2D H(C)N aromatic13C15N-A-C_D2Oisotropicsample_conditions_1
2D H(C)N aromatic13C15N-G-U_D2Oisotropicsample_conditions_1
2D H(C)N aliphatic13C15N-A-C_D2Oisotropicsample_conditions_1
2D H(C)N aliphatic13C15N-G-U_D2Oisotropicsample_conditions_1
2D H5(C5C4N3)H313C15N-G-U_H2Oisotropicsample_conditions_1
2D H5(C5C4N4)H413C15N-A-C_H2Oisotropicsample_conditions_1
TROSY relayed HCCH COSY13C15N-A-C_D2Oisotropicsample_conditions_1
2D 13C-15N HSQC13C15N_H2Oisotropicsample_conditions_1
2D 1H-15N HSQCunlabeled_GTP-13C15N_H2Oisotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlyunlabeled_GTP-13C15N_H2Oisotropicsample_conditions_1
2D 1H-13C HSQC aromaticunlabeled_GTP-13C15N_H2Oisotropicsample_conditions_1
2D 1H-13C HSQC aliphaticunlabeled_GTP-13C15N_D2Oisotropicsample_conditions_1
2D 1H-13C-NOESY aromaticunlabeled_GTP-13C15N_H2Oisotropicsample_conditions_1
2D 1H-13C-NOESY aliphaticunlabeled_GTP-13C15N_H2Oisotropicsample_conditions_1
2D HCCH-TOCSY13C15N-A-C_D2Oisotropicsample_conditions_1
2D CPMG-NOESY15N_H2Oisotropicsample_conditions_1
2D 1H-15N HSQC15N_H2Oisotropicsample_conditions_2
2D 1H-15N HSQC NH2 only15N_H2Oisotropicsample_conditions_2
2D 1H-1H NOESYunlabeled_H2Oisotropicsample_conditions_2
2D lr-1H-15N-HSQC15N_H2Oisotropicsample_conditions_1

Software:

CARA v1.8.4.2., Keller and Wuthrich - chemical shift assignment, data analysis, peak picking

TOPSPIN v2.1 to 3.5, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker Avance 950 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz

Related Database Links: