BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27652

Title: NZ118

Deposition date: 2018-10-16 Original release date: 2020-05-29

Authors: Jing, Haitao; Fu, Wenqiang

Citation: Jing, Haitao; Fu, Wenqiang. "1H Assigned Chemical Shifts for NZ118"  Not known ., .-..

Assembly members:
NZ118, polymer, 24 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
NZ118: GGGTTAGGGTTAGGGTTAGG GTTA

Data sets:
Data typeCount
1H chemical shifts111

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1NZ118, Chain A1
2NZ118, Chain B1
3NZ118, Chain C1
4NZ118, Chain D1

Entities:

Entity 1, NZ118, Chain A 24 residues - Formula weight is not available

1   DGDGDGDTDTDADGDGDGDT
2   DTDADGDGDGDTDTDADGDG
3   DGDTDTDA

Samples:

sample_1: NZ118 6 mM; potassium phosphate 5 mM

sample_conditions_1: pH: 6.8; temperature: 315 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

X-PLOR_NIH v2.46, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMR spectrometers:

  • Bruker Avance 850 MHz