BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27561

Title: protein-gapped DNA-nucelotide complex (Polymerase beta) ILV Methyl Assignments   PubMed: 30239932

Authors: Liptak, Cary; Mahmoud, Mariam; Eckenroth, Brian; Moreno, Marcus; East, Kyle; Alnajjar, Khadijeh; Huang, Ji; Towle-Weicksel, Jamie; Doubli, Sylvie; Loria, J Patrick; Sweasy, Joann

Citation: Liptak, Cary; Mahmoud, Mariam; Eckenroth, Brian; Moreno, Marcus; East, Kyle; Alnajjar, Khadijeh; Huang, Ji; Towle-Weicksel, Jamie; Doubli, Sylvie; Loria, J Patrick; Sweasy, Joann. "I260Q DNA polymerase beta highlights precatalytic conformational rearrangements critical for fidelity"  Nucleic Acids Res. 46, 10740-10756 (2018).

Assembly members:
DNA_Polymerase_beta, polymer, 335 residues, Formula weight is not available
gapped_DNA_template, polymer, 20 residues, Formula weight is not available
gapped_DNA_upstream, polymer, 11 residues, Formula weight is not available
gapped_DNA_downstream, polymer, 8 residues, Formula weight is not available
entity_XC5, non-polymer, 465.184 Da.

Natural source:   Common Name: Rat   Taxonomy ID: 10116   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Rattus norvegicus

Experimental source:   Production method: purified from the natural source   Host organism: Escherichia coli

Entity Sequences (FASTA):
DNA_Polymerase_beta: MSKRKAPQETLNGGITDMLV ELANFEKNVSQAIHKYNAYR KAASVIAKYPHKIKSGAEAK KLPGVGTKIAEKIDEFLATG KLRKLEKIRQDDTSSSINFL TRVTGIGPSAARKLVDEGIK TLEDLRKNEDKLNHHQRIGL KYFEDFEKRIPREEMLQMQD IVLNEVKKLDPEYIATVCGS FRRGAESSGDMDVLLTHPNF TSESSKQPKLLHRVVEQLQK VRFITDTLSKGETKFMGVCQ LPSENDENEYPHRRIDIRLI PKDQYYAGVLYFTGSDIFNK NMRAHALEKGFTINEYTIRP LGVTGVAGEPLPVDSEQDIF DYIQWRYREPKDRSE
gapped_DNA_template: CGACCGACGGCGCATCAGCC
gapped_DNA_upstream: GGCTGATGCGC
gapped_DNA_downstream: GTCGGTCG

Data sets:
Data typeCount
13C chemical shifts76
1H chemical shifts228

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1chain A1
2template2
3upstream3
4downstream4
5nuecleotide5

Entities:

Entity 1, chain A 335 residues - Formula weight is not available

1   METSERLYSARGLYSALAPROGLNGLUTHR
2   LEUASNGLYGLYILETHRASPMETLEUVAL
3   GLULEUALAASNPHEGLULYSASNVALSER
4   GLNALAILEHISLYSTYRASNALATYRARG
5   LYSALAALASERVALILEALALYSTYRPRO
6   HISLYSILELYSSERGLYALAGLUALALYS
7   LYSLEUPROGLYVALGLYTHRLYSILEALA
8   GLULYSILEASPGLUPHELEUALATHRGLY
9   LYSLEUARGLYSLEUGLULYSILEARGGLN
10   ASPASPTHRSERSERSERILEASNPHELEU
11   THRARGVALTHRGLYILEGLYPROSERALA
12   ALAARGLYSLEUVALASPGLUGLYILELYS
13   THRLEUGLUASPLEUARGLYSASNGLUASP
14   LYSLEUASNHISHISGLNARGILEGLYLEU
15   LYSTYRPHEGLUASPPHEGLULYSARGILE
16   PROARGGLUGLUMETLEUGLNMETGLNASP
17   ILEVALLEUASNGLUVALLYSLYSLEUASP
18   PROGLUTYRILEALATHRVALCYSGLYSER
19   PHEARGARGGLYALAGLUSERSERGLYASP
20   METASPVALLEULEUTHRHISPROASNPHE
21   THRSERGLUSERSERLYSGLNPROLYSLEU
22   LEUHISARGVALVALGLUGLNLEUGLNLYS
23   VALARGPHEILETHRASPTHRLEUSERLYS
24   GLYGLUTHRLYSPHEMETGLYVALCYSGLN
25   LEUPROSERGLUASNASPGLUASNGLUTYR
26   PROHISARGARGILEASPILEARGLEUILE
27   PROLYSASPGLNTYRTYRALAGLYVALLEU
28   TYRPHETHRGLYSERASPILEPHEASNLYS
29   ASNMETARGALAHISALALEUGLULYSGLY
30   PHETHRILEASNGLUTYRTHRILEARGPRO
31   LEUGLYVALTHRGLYVALALAGLYGLUPRO
32   LEUPROVALASPSERGLUGLNASPILEPHE
33   ASPTYRILEGLNTRPARGTYRARGGLUPRO
34   LYSASPARGSERGLU

Entity 2, template 20 residues - Formula weight is not available

1   DCDGDADCDCDGDADCDGDG
2   DCDGDCDADTDCDADGDCDC

Entity 3, upstream 11 residues - Formula weight is not available

1   DGDGDCDTDGDADTDGDCDG
2   DC

Entity 4, downstream 8 residues - Formula weight is not available

1   DGDTDCDGDGDTDCDG

Entity 5, nuecleotide - C10 H18 N3 O12 P3 - 465.184 Da.

1   XC5

Samples:

sample_1: DNA Polymerase beta, [U-13C; U-15N; U-2H; 99.5% 1HD-Ile,Leu; 99.5% 1HG-Val], 400 uM; potassium chloride 100 mM; HEPES 50 mM; DTT 2 mM; magnesium chloride 10 mM; gapped DNA template 700 mM; gapped DNA upstream 700 mM; gapped DNA downstream 700 mM; dCpcpp 712 mM

sample_conditions_1: pH: 7.36; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQC methylsample_1isotropicsample_conditions_1
HMCM[CG]CBCAsample_1isotropicsample_conditions_1
HMCM[CGCBCA]COsample_1isotropicsample_conditions_1
HMCM[CBCA]COsample_1isotropicsample_conditions_1
Methyl-Methyl HMQC-NOESY-HMQCsample_1isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Varian DD2 800 MHz
  • Varian INOVA 600 MHz

Related Database Links:

SP P06766 Q8K409