BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27452

Title: NMR resonance assignment for the SAM/SAH binding riboswitch RNA bound to S-Adenosylhomocysteine   PubMed: 30051308

Authors: Weickhmann, Anna Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Wunderlich, Christoph; Juen, Michael; Kremser, Johannes; Kreutz, Christoph; Woehnert, Jens

Citation: Weickhmann, A Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Strebitzer, Elisabeth; Juen, Michael; Kremser, Johannes; Wurm, Jan Philip; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the SAM/SAH-binding riboswitch RNA bound to S-adenosylhomocysteine"  Biomol. NMR Assign. 12, 329-334 (2018).

Assembly members:
env9b, polymer, 43 residues, Formula weight is not available
S-ADENOSYL-L-HOMOCYSTEINE, non-polymer, 384.411 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
env9b: GUCACAACGGCUUCCUGACG UGGCAGAUUGAAUUAUUGGA GCA

Data sets:
Data typeCount
13C chemical shifts313
15N chemical shifts126
1H chemical shifts318

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1env9b1
2SAH2

Entities:

Entity 1, env9b 43 residues - Formula weight is not available

1   GUCACAACGG
2   CUUCCUGACG
3   UGGCAGAUUG
4   AAUUAUUGGA
5   GCA

Entity 2, SAH - C14 H20 N6 O5 S - 384.411 Da.

1   SAH

Samples:

13C15N: env9b, [U-13C; U-15N], 710 uM; S-Adenosylhomocysteine 2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

15N: env9b, [U-15N], 910 uM; S-Adenosylhomocysteine 2.5 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-U: env9b, [U-13C; U-15N]-Ura, 800 uM; S-Adenosylhomocysteine 1.6 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

seldeut: env9b, [U-5-D1/ribose-3 ,4 ,5 ,5 -D4], 750 uM; S-Adenosylhomocysteine 3 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-SAH: env9b 700 uM; S-Adenosylhomocysteine, [U-13C; U-15N], 0.5 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-AC: env9b, [U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade, 800 uM; S-Adenosylhomocysteine 2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-G: env9b, [U-13C; U-15N]-Gua, 850 uM; S-Adenosylhomocysteine 2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

unlab: env9b 1.2 uM; S-Adenosylhomocysteine 4 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-AC_D2O: env9b, [U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade, 800 uM; S-Adenosylhomocysteine 2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-U_D2O: env9b, [U-13C; U-15N]-Ura, 800 uM; S-Adenosylhomocysteine 1.6 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-G_D2O: env9b, [U-13C; U-15N]-Gua, 850 uM; S-Adenosylhomocysteine 2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

13C15N-U_13C15N-SAH: env9b, [U-13C; U-15N]-Ura, 480 uM; S-Adenosylhomocysteine, [U-13C; U-15N], 750 mM; potassium phosphate 25 mM; potassium chloride 50 mM; magnesium acetate 2 mM

298K: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

283K: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

271K: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 271 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQC13C15Nisotropic283K
2D 1H-15N HSQC13C15N-Uisotropic283K
2D 1H-15N HSQC13C15N-ACisotropic283K
2D 1H-15N HSQC13C15N-Gisotropic283K
2D 1H-15N HSQC NH2 only15Nisotropic298K
2D 1H-13C HSQC aliphatic13C15Nisotropic298K
2D 1H-13C HSQC aliphatic13C15N-ACisotropic298K
2D 1H-13C HSQC aliphatic13C15N-Uisotropic298K
2D 1H-13C HSQC aliphatic13C15N-Gisotropic298K
2D 1H-13C HSQC aromatic13C15Nisotropic298K
2D 1H-13C HSQC aromatic13C15N-ACisotropic298K
2D 1H-13C HSQC aromatic13C15N-Uisotropic298K
2D 1H-13C HSQC aromatic13C15N-Gisotropic298K
2D 1H-1H NOESYunlabisotropic298K
3D 1H-13C NOESY aromatic13C15N-ACisotropic298K
3D 1H-13C NOESY aromatic13C15N-Uisotropic298K
3D 1H-13C NOESY aromatic13C15N-Gisotropic298K
3D 1H-13C NOESY aliphatic13C15N-AC_D2Oisotropic298K
3D 1H-13C NOESY aliphatic13C15N-U_D2Oisotropic298K
3D 1H-13C NOESY aliphatic13C15N-G_D2Oisotropic298K
2D 1H-1H NOESYunlabisotropic271K
3D HCCH-TOCSY13C15N-AC_D2Oisotropic298K
3D HCCH-COSY13C15N-AC_D2Oisotropic298K
3D HCCH-TOCSY13C15N-U_D2Oisotropic298K
3D HCCH-COSY13C15N-U_D2Oisotropic298K
3D HCCH-TOCSY13C15N-G_D2Oisotropic298K
3D HCCH-COSY13C15N-G_D2Oisotropic298K
1D 1H-HS11ECHOunlabisotropic283K
2D 1H-15N HNN-COSY13C15Nisotropic283K
2D 1H-13C HNCO13C15N-Gisotropic298K
2D 1H-13C HNCO13C15N-Uisotropic298K
2D 1H-13C H5C5(C4N)H13C15N-ACisotropic298K
2D 1H-15N HCN aromatic13C15N-Uisotropic298K
2D 1H-15N HCN aliphatic13C15N-U_D2Oisotropic298K
2D 1H-15N 2bond-HSQC15Nisotropic298K
TROSY relayed HCCH-COSY13C15N-AC_D2Oisotropic298K
2D 1H-13C long-rangeH8(C8)C5(N1)H113C15N-Gisotropic298K
2D 1H-13C H5C5(C4N)H13C15N-Uisotropic298K
2D 1H-15N HCN aromatic13C15N-ACisotropic298K
2D 1H-15N HCN aliphatic13C15N-AC_D2Oisotropic298K
2D 1H-15N HCN aromatic13C15N-Gisotropic298K
2D 1H-15N HCN aliphatic13C15N-G_D2Oisotropic298K
2D 1H-15N HNN-COSY13C15N-U_13C15N-SAHisotropic283K
2D 1H-15N HSQC15Nisotropic271K
2D lr-1H,15N-HSQC15Nisotropic298K
2D 1H-13C HSQC aliphatic13C15N-SAHisotropic298K
2D 1H-13C HSQC aromatic13C15N-SAHisotropic298K
3D HCCH-COSY13C15N-SAHisotropic298K

Software:

TOPSPIN v3.2 or 3.5, Bruker - processing

CARA v1.9.1b9, Keller and Wuthrich - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 950 MHz
  • Bruker Avance 900 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz

Related Database Links:

EMBL RF01727