BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27404

Title: 1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of K93A human flap endonuclease-1 in complex with dual-hairpin DNA substrate   PubMed: 29718417

Authors: Bennet, Ian; Baxter, Nicola

Citation: Bennet, Ian; Finger, L David; Baxter, Nicola; Ambrose, Benjamin; Hounslow, Andrea; Thompson, Mark; Exell, Jack; Shahari, Nur Nazihah; Craggs, Timothy; Waltho, Jonathan; Grasby, Jane. "Regional conformational flexibility couples substrate specificity and scissile phosphate diester selectivity in human flap endonuclease 1"  Nucleic Acids Res. 46, 5618-5633 (2018).

Assembly members:
hFEN1-K93A, polymer, 341 residues, 38400.08 Da.
entity_CA, non-polymer, 40.078 Da.
dual-hairpin_DNA_substrate, polymer, 41 residues, 12611.2 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
hFEN1-K93A: GIQGLAKLIADVAPSAIREN DIKSYFGRKVAIDASMSIYQ FLIAVRQGGDVLQNEEGETT SHLMGMFYRTIRMMENGIKP VYVFDGKPPQLASGELAKRS ERRAEAEKQLQQAQAAGAEQ EVEKFTKRLVKVTKQHNDEC KHLLSLMGIPYLDAPSEAEA SCAALVKAGKVYAAATEDMD CLTFGSPVLMRHLTASEAKK LPIQEFHLSRILQELGLNQE QFVDLCILLGSDYCESIRGI GPKRAVDLIQKHKSIEEIVR RLDPNKYPVPENWLHKEAHQ LFLEPEVLDPESVELKWSEP NEEELIKFMCGEKQFSEERI RSGVKRLSKSRQGSTLEVLF Q
dual-hairpin_DNA_substrate: TGAAAGGCAGAGCGCTAGCT CTGCCTTTCGAGCGAAGCTC C

Data sets:
Data typeCount
13C chemical shifts280
15N chemical shifts132
1H chemical shifts132

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1hFEN1-336-K93A-DNA1
2Calcium ion2
3dual-hairpin DNA substrate3

Entities:

Entity 1, hFEN1-336-K93A-DNA 341 residues - 38400.08 Da.

1   GLYILEGLNGLYLEUALALYSLEUILEALA
2   ASPVALALAPROSERALAILEARGGLUASN
3   ASPILELYSSERTYRPHEGLYARGLYSVAL
4   ALAILEASPALASERMETSERILETYRGLN
5   PHELEUILEALAVALARGGLNGLYGLYASP
6   VALLEUGLNASNGLUGLUGLYGLUTHRTHR
7   SERHISLEUMETGLYMETPHETYRARGTHR
8   ILEARGMETMETGLUASNGLYILELYSPRO
9   VALTYRVALPHEASPGLYLYSPROPROGLN
10   LEUALASERGLYGLULEUALALYSARGSER
11   GLUARGARGALAGLUALAGLULYSGLNLEU
12   GLNGLNALAGLNALAALAGLYALAGLUGLN
13   GLUVALGLULYSPHETHRLYSARGLEUVAL
14   LYSVALTHRLYSGLNHISASNASPGLUCYS
15   LYSHISLEULEUSERLEUMETGLYILEPRO
16   TYRLEUASPALAPROSERGLUALAGLUALA
17   SERCYSALAALALEUVALLYSALAGLYLYS
18   VALTYRALAALAALATHRGLUASPMETASP
19   CYSLEUTHRPHEGLYSERPROVALLEUMET
20   ARGHISLEUTHRALASERGLUALALYSLYS
21   LEUPROILEGLNGLUPHEHISLEUSERARG
22   ILELEUGLNGLULEUGLYLEUASNGLNGLU
23   GLNPHEVALASPLEUCYSILELEULEUGLY
24   SERASPTYRCYSGLUSERILEARGGLYILE
25   GLYPROLYSARGALAVALASPLEUILEGLN
26   LYSHISLYSSERILEGLUGLUILEVALARG
27   ARGLEUASPPROASNLYSTYRPROVALPRO
28   GLUASNTRPLEUHISLYSGLUALAHISGLN
29   LEUPHELEUGLUPROGLUVALLEUASPPRO
30   GLUSERVALGLULEULYSTRPSERGLUPRO
31   ASNGLUGLUGLULEUILELYSPHEMETCYS
32   GLYGLULYSGLNPHESERGLUGLUARGILE
33   ARGSERGLYVALLYSARGLEUSERLYSSER
34   ARGGLNGLYSERTHRLEUGLUVALLEUPHE
35   GLN

Entity 2, Calcium ion - Ca - 40.078 Da.

1   CA

Entity 3, dual-hairpin DNA substrate 41 residues - 12611.2 Da.

1   DTDGDADADADGDGDCDADG
2   DADGDCDGDCDTDADGDCDT
3   DCDTDGDCDCDTDTDTDCDG
4   DADGDCDGDADADGDCDTDC
5   DC

Samples:

sample_1: hFEN1-K93A, [U-100% 13C; U-100% 15N; U-80% 2H], 0.5 mM; HEPES 10 mM; potassium chloride 6 mM; sodium azide 4 mM; D2O, [U-99% 2H], 10%; H2O 90%; TSP, [U-99% 2H], 0.05 mM; beta-mercaptoethanol 100 mM; calcium chloride 8 mM; dual-hairpin DNA substrate 0.55 mM

sample_conditions_1: ionic strength: 60 mM; pH: 7.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N TROSYsample_1isotropicsample_conditions_1
3D TROSY-HNCAsample_1isotropicsample_conditions_1
3D TROSY-HN(CO)CAsample_1isotropicsample_conditions_1
3D TROSY-HNCACBsample_1isotropicsample_conditions_1
3D TROSY-HN(CO)CACBsample_1isotropicsample_conditions_1
3D TROSY-HN(CA)COsample_1isotropicsample_conditions_1
3D TROSY-HNCOsample_1isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection

Felix, Accelrys Software Inc. - processing

CCPN_Analysis, CCPN - chemical shift assignment, data analysis, peak picking

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: