BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27289

Title: Structure of the 30 kDa HIV-1 RNA Dimerization Signal by a Hybrid Cryo-EM, NMR and Molecular Dynamics Approach   PubMed: 29398526

Authors: Keane, Sarah; Summers, Michael

Citation: Zhang, Kaiming; Keane, Sarah; Zhaoming, Su; Irobalieva, Rossitza; Chen, Muyuan; Van, Verna; Sciandra, Carly; Marchant, Jan; Heng, Xiao; Schmid, Michael; Case, David; Ludtke, Steven; Summers, Michael; Chiu, Wah. "Structure of the 30 kDa HIV-1 RNA Dimerization Signal by a Hybrid Cryo-EM, NMR, and Molecular Dynamics Approach"  Structure S0969-2126, 30001-30007 (2018).

Assembly members:
DIS, polymer, 47 residues, Formula weight is not available

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: recombinant technology   Host organism: in vitro transcription

Entity Sequences (FASTA):
DIS: GGCAGGACUCGGCUUGCUGA AGCGCGCACGGCAAGAGGCG AGGGGCC

Data sets:
Data typeCount
1H chemical shifts214

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DIS1

Entities:

Entity 1, DIS 47 residues - Formula weight is not available

1   GGCAGGACUC
2   GGCUUGCUGA
3   AGCGCGCACG
4   GCAAGAGGCG
5   AGGGGCC

Samples:

DIS_G8C6r: DIS, G8C6r, 300 uM; TRIS, [U-2H], 20 mM

DIS_H: DIS 300 uM; TRIS, [U-2H], 20 mM

DIS_A2rGr: DIS, A2rGr, 300 uM; TRIS, [U-2H], 20 mM

DIS_A28GH: DIS, A28GH, 300 uM; TRIS, [U-2H], 20 mM

sample_conditions_1: pH: 7.5; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYDIS_Hisotropicsample_conditions_1
2D 1H-1H NOESYDIS_A2rGrisotropicsample_conditions_1
2D 1H-1H NOESYDIS_A28GHisotropicsample_conditions_1
2D 1H-1H NOESYDIS_G8C6risotropicsample_conditions_1

Software:

NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis, processing

TOPSPIN, Bruker Biospin - collection

CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: