BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 26939

Title: Iminoproton chemical shifts of ASH1 E3 42mer RNA stem-loop   PubMed: 28092367

Authors: Schlundt, Andreas; Sattler, Michael; Edelmann, Franziska; Niessing, Dierk

Citation: Edelmann, Franziska; Schlundt, Andreas; Heym, Roland; Jenner, Andreas; Niedner-Boblenz, Annika; Syed, Muhammad; Paillart, Jean-Christophe; Stehle, Ralf; Janowski, Robert; Sattler, Michael; Jansen, Ralf-Peter; Niessing, Dierk. "Molecular architecture and dynamics of ASH1 mRNA recognition by its mRNA-transport complex"  Nat. Struct. Biol. 24, 152-161 (2017).

Assembly members:
ASH1-E3_42mer, polymer, 42 residues, Formula weight is not available

Natural source:   Common Name: baker's yeast   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: cell free synthesis   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
ASH1-E3_42mer: GAUAACUGAAUCGCUAAGGA UGAAAGUCUAUGCGACAUUA UC

Data sets:
Data typeCount
1H chemical shifts16

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1ASH1-mRNA E3 42mer stem-loop1

Entities:

Entity 1, ASH1-mRNA E3 42mer stem-loop 42 residues - Formula weight is not available

Sequence comprises three fragments corresponding to A, B and C in the CS files. A (1774-1785) and B (1803-1811) are strands of the wt stem sequence and C is an artificial stem-loop (gcuaaggaugaaagucuaugc).

1   GAUAACUGAA
2   UCGCUAAGGA
3   UGAAAGUCUA
4   UGCGACAUUA
5   UC

Samples:

sample_1: ASH1-E3_42mer 200 uM; HEPES 20 mM; sodium chloride 150 mM; magnesium chloride 2 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 0.15 M; pH: 7.5; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

TOPSPIN v3.5, Bruker Biospin, CCPN - chemical shift assignment, collection

NMR spectrometers:

  • Bruker Avance 900 MHz

Related Database Links:

PDB