BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 26934

Title: Solution Structure of first stem-loop of Escherichia coli DsrA RNA   PubMed: 28934467

Authors: Wu, Pengzhi; Wu, Jihui; Shi, Yunyu

Citation: Wu, Pengzhi; Liu, Xiaodan; Yang, Lingna; Sun, Yitong; Gong, Qingguo; Wu, Jihui; Shi, Yunyu. "The important conformational plasticity of DsrA sRNA for adapting multiple target regulation."  Nucleic Acids Res. 45, 9625-9639 (2017).

Assembly members:
RNA_(23-MER), polymer, 23 residues, Formula weight is not available

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(23-MER): GGACAUCAGAUUUCCUGGUG UCC

Data sets:
Data typeCount
13C chemical shifts140
15N chemical shifts27
1H chemical shifts203

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (23-MER)1

Entities:

Entity 1, RNA (23-MER) 23 residues - Formula weight is not available

1   GGACAUCAGA
2   UUUCCUGGUG
3   UCC

Samples:

sample_1: RNA_(23-MER) 0.7 mM; sodium phosphate 10 mM; sodium chloride 50 mM

sample_2: RNA_(23-MER) 0.7 mM; sodium phosphate 10 mM; sodium chloride 50 mM

sample_3: RNA_(23-MER), [U-100% 13C; U-100% 15N], 0.7 mM; sodium phosphate 10 mM; sodium chloride 50 mM

sample_4: RNA_(23-MER), [U-100% 13C; U-100% 15N], 0.7 mM; sodium phosphate 10 mM; sodium chloride 50 mM

sample_conditions_1: ionic strength: 60 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 60 mM; pH: 6.5; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HNN-COSYsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlysample_3isotropicsample_conditions_1
3D 1H-15N NOESYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D DQF-COSYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-13C HSQC aliphaticsample_4isotropicsample_conditions_2
2D 1H-13C HSQC aromaticsample_4isotropicsample_conditions_2
2D HCNsample_4isotropicsample_conditions_2
3D HCCH-COSYsample_4isotropicsample_conditions_2
3D HCCH-TOCSYsample_4isotropicsample_conditions_2
3D 1H-13C NOESYsample_4isotropicsample_conditions_2

Software:

SPARKY, Goddard - chemical shift assignment, peak picking

xwinnmr, Bruker Biospin - collection, processing

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Bruker DMX 600 MHz
  • Varian Uniform NMR System 700 MHz

Related Database Links: