BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 26842

Title: NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine   PubMed: 27730489

Authors: Elke, Duchardt-Ferner; Juen, Michael; Kreutz, Christoph; Wohnert, Jens

Citation: Duchardt-Ferner, Elke; Juen, Michael; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine"  Biomol. NMR Assign. 11, 29-34 (2017).

Assembly members:
TMR-3_48nt, polymer, 48 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: reverse transcriptase   Host organism: Escherichia coli

Entity Sequences (FASTA):
TMR-3_48nt: GGACGACUGAACCGAAAGGU UCUUGGCUGCUUCGGCAGAG GUACGUCC

Data sets:
Data typeCount
13C chemical shifts382
15N chemical shifts157
1H chemical shifts415
31P chemical shifts3

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1TMR-3_48nt1

Entities:

Entity 1, TMR-3_48nt 48 residues - Formula weight is not available

1   GGACGACUGA
2   ACCGAAAGGU
3   UCUUGGCUGC
4   UUCGGCAGAG
5   GUACGUCC

Samples:

unlabeled_sample: TMR-3_48nt 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM; H2O 95 v/v

13C-15N_sample: TMR-3_48nt, [U-13C; U-15N], 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM

15N_sample: TMR-3_48nt, [U-15N], 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; K-glutamate 130 mM

A-C-13C-15N_sample_H2O: TMR-3_48nt, [U-13C; U-15N]-Ade,Cyt, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; K-glutamate 130 mM

G-U-13C-15N_sample_H2O: TMR-3_48nt, [U-13C; U-15N]-Gua,Ura, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM

A-C-13C-15N_sample_D2O: TMR-3_48nt, [U-13C; U-15N]-Ade,Cyt, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 100 v/v; sodium chloride 10 mM; K-glutamate 130 mM

G-U-13C-15N_sample_D2O: TMR-3_48nt, [U-13C; U-15N]-Gua,Ura, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 100 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM

283K: ionic strength: 0.41 M; pH: 7.5; pressure: 1 atm; temperature: 283 K

298K: ionic strength: 0.28 M; pH: 7.5; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
3D 1H-13C NOESY aromatic13C-15N_sampleisotropic298K
3D 1H-13C NOESY aliphatic13C-15N_sampleisotropic298K
3D 1H-13C NOESY aromaticA-C-13C-15N_sample_H2Oisotropic298K
3D 1H-13C NOESY aliphaticA-C-13C-15N_sample_D2Oisotropic298K
3D 1H-13C NOESY aromaticG-U-13C-15N_sample_H2Oisotropic298K
3D 1H-13C NOESY aliphaticG-U-13C-15N_sample_D2Oisotropic298K
2D 1H-1H NOESY15N_sampleisotropic283K
2D 1H-15N HSQC15N_sampleisotropic283K
2D 1H-15N HSQC NH2 only15N_sampleisotropic283K
SELLR HNN-COSY15N_sampleisotropic298K
HNN-COSY15N_sampleisotropic298K
amino HNN-COSY15N_sampleisotropic298K
H1/H8 13C-HMBCG-U-13C-15N_sample_H2Oisotropic298K
2D H5(C5C4N3)H3G-U-13C-15N_sample_H2Oisotropic298K
2D H5(C5C4N4)H4A-C-13C-15N_sample_H2Oisotropic298K
2D H(C)N aromaticA-C-13C-15N_sample_D2Oisotropic298K
2D H(C)N aliphaticA-C-13C-15N_sample_D2Oisotropic298K
2D H(C)N aromaticG-U-13C-15N_sample_D2Oisotropic298K
2D H(C)N aliphaticG-U-13C-15N_sample_D2Oisotropic298K
3D HCCH-TOCSYA-C-13C-15N_sample_D2Oisotropic298K
3D HCCH-TOCSYG-U-13C-15N_sample_D2Oisotropic298K
3D HCCH-COSYA-C-13C-15N_sample_D2Oisotropic298K
3D HCCH-COSYG-U-13C-15N_sample_D2Oisotropic298K
2D H(N)COG-U-13C-15N_sample_H2Oisotropic298K
H6-C2/C4 lr13C-HSQCunlabeled_sampleisotropic298K
H5-N3 lr15N-HSQCG-U-13C-15N_sample_H2Oisotropic298K
TROSY relayed HCCH COSYA-C-13C-15N_sample_D2Oisotropic298K
2D H(C)PA-C-13C-15N_sample_D2Oisotropic298K
2D H(C)PG-U-13C-15N_sample_D2Oisotropic298K

Software:

TOPSPIN v3.2, Bruker Biospin - acquisition, processing

CARA, Keller and Wuthrich - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 950 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz

Related Database Links: