BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 26505

Title: 13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA Binding Site for Human U1A Protein   PubMed: 15890361

Authors: Shajani, Zahra; Varani, Gabriele

Citation: Shajani, Zahra; Varani, Gabriele. "13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA"  J. Mol. Biol. 349, 699-715 (2005).

Assembly members:
3'-UTR, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
3'-UTR: GGCAGAGUCCUUCGGGACAU UGCACCUGCC

Data typeCount
heteronuclear NOE values97
T1 relaxation values98
T1rho relaxation values98
order parameters65

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all