BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 26024

Title: RNA Bulge Loop that Specifically Binds Metal Ions   PubMed: 27631837

Authors: Gu, Xiaobo; Schroeder, Susan

Citation: Gu, Xiaobo; Park, Sun-Young; Tonelli, Marco; Cornilescu, Gabriel; Xia, Tianbing; Zhong, Dongping; Schroeder, Susan. "NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions"  J. Phys. Chem. Lett. ., 3841-3846 (2016).

Assembly members:
RNA_(28-MER), polymer, 28 residues, 8970.434 Da.

Natural source:   Common Name: bacteriophage   Taxonomy ID: 38018   Superkingdom: Viruses   Kingdom: not available   Genus/species: not available unidentified phage

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Transcription of RNA using T7 polymerase

Entity Sequences (FASTA):
RNA_(28-MER): GGACGUUAAAAGGCUUCGGC CUACGUCC

Data sets:
Data typeCount
13C chemical shifts78
15N chemical shifts11
1H chemical shifts184

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (28-MER)1

Entities:

Entity 1, RNA (28-MER) 28 residues - 8970.434 Da.

1   GGACGUUAAA
2   AGGCUUCGGC
3   CUACGUCC

Samples:

AU_label: RNA (28-MER), [U-98% 13C; U-98% 15N]-A,U, 1.5 mM; cobalt hexamine 1.5 mM; sodium chloride 10 mM; sodium phosphate 10 mM

NO_label: RNA (28-MER) 1 mM; cobalt hexamine 1 mM; sodium chloride 10 mM; sodium phosphate 10 mM

AU_label_RDC: RNA (28-MER), [U-98% 13C; U-98% 15N]-A,U, 1.5 mM; cobalt hexamine 1.5 mM; phage 5 mg/mL; sodium chloride 10 mM; sodium phosphate 10 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 20 mM; pH: 6; pressure: 1 bar; temperature: 274 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCAU_labelisotropicsample_conditions_1
3D HCCH-TOCSYAU_labelisotropicsample_conditions_1
2D NOESY13CHSQCAU_labelisotropicsample_conditions_1
2D HCNTROSYAU_labelisotropicsample_conditions_1
2D NOESYAU_labelisotropicsample_conditions_1
2D 1H-13C HSQCAU_label_RDCisotropicsample_conditions_1
2D NOESYNO_labelisotropicsample_conditions_2
2D COSYNO_labelisotropicsample_conditions_2
2D 1H-13C HSQCNO_labelisotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Varian VNMRS 500 MHz
  • Agilent INOVA 900 MHz
  • Agilent INOVA 800 MHz
  • Agilent NMR System 600 MHz

Related Database Links: