BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25999

Title: Solution structure of the St domain of EMCV IRES   PubMed: 27525590

Authors: Imai, Shunsuke; D'Souza, Victoria; Wagner, Gerhard

Citation: Imai, Shunsuke; Hellen, Christopher; D'Souza, Victoria; Wagner, Gerhard. "An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation"  Nat. Struct. Mol. Biol. 23, 859-864 (2016).

Assembly members:
RNA_(28-MER), polymer, 28 residues, 9128.561 Da.

Natural source:   Common Name: Encephalomyocarditis virus   Taxonomy ID: 12104   Superkingdom: Viruses   Kingdom: not available   Genus/species: Cardiovirus not available

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(28-MER): GGGCUGAAGGAUGGAGACGU CUAGGCCC

Data sets:
Data typeCount
13C chemical shifts164
1H chemical shifts188

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (28-MER)1

Entities:

Entity 1, RNA (28-MER) 28 residues - 9128.561 Da.

1   GGGCUGAAGG
2   AUGGAGACGU
3   CUAGGCCC

Samples:

sample_1: RNA (28-MER) 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%

sample_2: RNA (28-MER) 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; H2O 90%; D2O, [U-2H], 10%

sample_3: RNA (28-MER), [U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%

sample_4: RNA (28-MER), [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%

sample_5: RNA (28-MER), [U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; H2O 90%; D2O, [U-2H], 10%

sample_6: RNA (28-MER), [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; H2O 90%; D2O, [U-2H], 10%

sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 308 K

sample_conditions_2: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K

sample_conditions_3: ionic strength: 20 mM; pH: 5.5; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_2isotropicsample_conditions_3
2D 1H-13C HSQCsample_3isotropicsample_conditions_1
3D 1H-13C NOESYsample_3isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
3D 1H-13C NOESYsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_2
2D 1H-15N HSQCsample_5isotropicsample_conditions_3
2D 1H-15N HSQCsample_6isotropicsample_conditions_2
2D 1H-15N HSQCsample_6isotropicsample_conditions_3

Software:

CARA, Keller and Wuthrich - chemical shift assignment

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz

Related Database Links: