BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25867

Title: An NMR/SAXS structure of the PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES   PubMed: 26554019

Authors: Au, Hilda; Cornilescu, Gabriel; Mouzakis, Kathryn; Burke, Jordan; Ren, Qian; Lee, Seonghoon; Butcher, Samuel; Jan, Eric

Citation: Au, Hilda; Cornilescu, Gabriel; Mouzakis, Kathryn; Ren, Qian; Burke, Jordan; Lee, Seonghoon; Butcher, Samuel; Jan, Eric. "Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection"  Proc. Natl. Acad. Sci. U.S.A. 112, E6446-E6455 (2015).

Assembly members:
RNA_(70-MER), polymer, 70 residues, 22565.592 Da.

Natural source:   Common Name: honey bee   Taxonomy ID: 7460   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Apis mellifera

Experimental source:   Production method: cell free synthesis   Host organism: E. coli - cell free

Entity Sequences (FASTA):
RNA_(70-MER): GGAACAGCUGUACUGGGCAG UUACAGCAGUCGUAUGGUAA CACAUGCGGCGUUCCGAAAU ACCAUGCCUG

Data sets:
Data typeCount
15N chemical shifts29
1H chemical shifts29

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (70-MER)1

Entities:

Entity 1, RNA (70-MER) 70 residues - 22565.592 Da.

1   GGAACAGCUG
2   UACUGGGCAG
3   UUACAGCAGU
4   CGUAUGGUAA
5   CACAUGCGGC
6   GUUCCGAAAU
7   ACCAUGCCUG

Samples:

sample_1: RNA (70-MER), [U-13C; U-15N]-Gua, 0.53 – 0.70 mM; potassium phosphate 10 mM; potassium chloride 200 mM; Ethylenediaminetetraacetic acid 50 uM; H2O 90%; D2O 10%

sample_2: RNA (70-MER), [U-13C; U-15N]-Gua, 0.53 – 0.70 mM; Pf1 phage 12.5 mg/ml; potassium phosphate 10 mM; potassium chloride 200 mM; Ethylenediaminetetraacetic acid 50 uM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 0.225 M; pH: 6.3; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N TROSY-HMQCsample_1isotropicsample_conditions_1
2D 1H-15N TROSY-HMQCsample_2anisotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection

SPARKY, Goddard - chemical shift assignment

MC-SIM v4.2.2, Parisien, Major - structure solution

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, peak picking

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 700 MHz

Related Database Links: