BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25831

Title: solution structure of the complex of microRNA 20b pre-element with Rbfox RRM   PubMed: 27001519

Authors: Yang, Fan; Chen, Yu; Varani, Gabriele

Citation: Chen, Yu; Zubovic, Lorena; Yang, Fan; Godin, Katherine; Pavelitz, Tom; Castellanos, Javier; Macchi, Paolo; Varani, Gabriele. "Rbfox proteins regulate microRNA biogenesis by sequence-specific binding to their precursors and target downstream Dicer"  Nucleic Acids Res. 44, 4381-4395 (2016).

Assembly members:
miR-20b, polymer, 23 residues, 7318.388 Da.
Rbfox_RRM, polymer, 104 residues, Formula weight is not available

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: T7 in vitro transcription   Host organism: NA

Entity Sequences (FASTA):
miR-20b: GGUAGUUUUGGCAUGACUCU ACC
Rbfox_RRM: GSHMNTENKSQPKRLHVSNI PFRFRDPDLRQMFGQFGKIL DVEIIFNERGSKGFGFVTFE NSADADRAREKLHGTVVEGR KIEVNNATARVMTNKKTVNP YTNG

Data sets:
Data typeCount
13C chemical shifts566
15N chemical shifts115
1H chemical shifts838

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1miR-20b1
2Rbfox_RRM2

Entities:

Entity 1, miR-20b 23 residues - 7318.388 Da.

1   GGUAGUUUUG
2   GCAUGACUCU
3   ACC

Entity 2, Rbfox_RRM 104 residues - Formula weight is not available

1   GLYSERHISMETASNTHRGLUASNLYSSER
2   GLNPROLYSARGLEUHISVALSERASNILE
3   PROPHEARGPHEARGASPPROASPLEUARG
4   GLNMETPHEGLYGLNPHEGLYLYSILELEU
5   ASPVALGLUILEILEPHEASNGLUARGGLY
6   SERLYSGLYPHEGLYPHEVALTHRPHEGLU
7   ASNSERALAASPALAASPARGALAARGGLU
8   LYSLEUHISGLYTHRVALVALGLUGLYARG
9   LYSILEGLUVALASNASNALATHRALAARG
10   VALMETTHRASNLYSLYSTHRVALASNPRO
11   TYRTHRASNGLY

Samples:

sample_1: miR-20b 1 mM; sodium phosphate 10 mM; sodium chloride 20 mM; Rbfox RRM, [U-99% 13C; U-99% 15N], 1 mM; H2O 90%; D2O 10%

sample_2: miR-20b 1 mM; sodium phosphate 10 mM; sodium chloride 20 mM; Rbfox RRM, [U-99% 13C; U-99% 15N], 1 mM; D2O 100%

sample_3: miR-20b, [U-99% 13C; U-99% 15N], 1 mM; sodium phosphate 10 mM; sodium chloride 20 mM; Rbfox RRM 1 mM; D2O 100%

sample_4: miR-20b, [U-99% 13C; U-99% 15N], 1 mM; sodium phosphate 10 mM; sodium chloride 20 mM; Rbfox RRM 1 mM; H2O 90%; D2O 10%

sample_conditions_1: pH: 6.5; pressure: 1 atm; temperature: 279 K

sample_conditions_2: pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D F1-, F2-filtered 1H-1H NOESYsample_1isotropicsample_conditions_1
2D F1-, F2-filtered 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_2
3D 1H-13C NOESYsample_2isotropicsample_conditions_2
2D 1H-15N HSQCsample_1isotropicsample_conditions_2
3D 1H-15N NOESYsample_1isotropicsample_conditions_2
3D CBCA(CO)NHsample_1isotropicsample_conditions_2
3D HNCACBsample_1isotropicsample_conditions_2
3D HNCOsample_1isotropicsample_conditions_2
3D HBHA(CO)NHsample_1isotropicsample_conditions_2
3D HCCH-TOCSYsample_2isotropicsample_conditions_2
3D CCH-TOCSYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_3isotropicsample_conditions_2
3D 1H-13C NOESYsample_3isotropicsample_conditions_2
2D 1H-15N HSQCsample_4isotropicsample_conditions_1
3D 13C F1-filtered, F3-edited NOESY-HSQCsample_2isotropicsample_conditions_2

Software:

TOPSPIN, Bruker Biospin - collection

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

CcpNMR, CCPN - chemical shift assignment, data analysis, peak picking

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

TALOS, Cornilescu, Delaglio and Bax - geometry optimization

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz

Related Database Links: