BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25811

Title: NMR-SAXS/WAXS Structure of the core of the U4/U6 di-snRNA   PubMed: 26655855

Authors: Cornilescu, Gabriel; Didychuk, Allison; Rodgers, Margaret; Michael, Lauren; Burke, Jordan; Montemayor, Eric; Hoskins, Aaron; Butcher, Samuel; Tonelli, Marco

Citation: Cornilescu, Gabriel; Didychuk, Allison; Rodgers, Margaret; Michael, Lauren; Burke, Jordan; Montemayor, Eric; Hoskins, Aaron; Butcher, Samuel. "Structural analysis of multi-helical RNAs by NMR-SAXS/WAXS: Application to the U4/U6 di-snRNA"  J. Mol. Biol. 428, 777-789 (2015).

Assembly members:
RNA_(92-MER), polymer, 92 residues, 29563.637 Da.

Natural source:   Common Name: baker's yeast   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(92-MER): GGCCUUAUGCACGGGAAAUA CGCAUAUCAGUGAGGAUUCG UCCGAGAUUGUGUUUUUGCU GGUGUAAAUCAGCAGUUCCC CUGCAUAAGGCU

Data sets:
Data typeCount
13C chemical shifts5
15N chemical shifts25
1H chemical shifts30

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (92-MER)1

Entities:

Entity 1, RNA (92-MER) 92 residues - 29563.637 Da.

Contains two G nucleotides for transcription, then snRNA U4 nucleotides 3-63, a GUAA linker, U6 snRNA nucleotides 56-80 with an A79C mutation.

1   GGCCUUAUGC
2   ACGGGAAAUA
3   CGCAUAUCAG
4   UGAGGAUUCG
5   UCCGAGAUUG
6   UGUUUUUGCU
7   GGUGUAAAUC
8   AGCAGUUCCC
9   CUGCAUAAGG
10   CU

Samples:

sample_1A: RNA (92-MER), [U-13C; U-15N]-Gua, -Ura, 0.6 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM

sample_2A: RNA (92-MER), [U-13C; U-15N]-Ade, 0.7 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM

sample_1B: RNA (92-MER), [U-13C; U-15N]-Gua, -Ura, 0.6 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM; Pf1 phage 5 mg/mL

sample_2B: RNA (92-MER), [U-13C; U-15N]-Ade, 0.7 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM; Pf1 phage 5 mg/mL

sample_conditions_1: ionic strength: 58.5 mM; pH: 7.0; pressure: 1 atm; temperature: 273 K

sample_conditions_2: ionic strength: 58.5 mM; pH: 7.0; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1Aisotropicsample_conditions_1
2D 1H-15N HSQCsample_1Banisotropicsample_conditions_1
2D 1H-13C HSQCsample_2Aisotropicsample_conditions_2
2D 1H-13C HSQCsample_2Banisotropicsample_conditions_2

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - peak picking

NMR spectrometers:

  • Agilent INOVA 900 MHz
  • Agilent INOVA 800 MHz
  • Bruker DMX 750 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz

Related Database Links: