BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25780

Title: Structure of CssA4 (bottom stem) of CssA thermometer   PubMed: 27369378

Authors: Barnwal, Ravi; Godin, Kate; Varani, Gabriele; Loh, Edmund; Yip, Jordan; Tang, Christoph

Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis"  Nucleic Acids Res. 44, 9426-9437 (2016).

Assembly members:
RNA_(36-MER), polymer, 36 residues, 11474.870 Da.

Natural source:   Common Name: b-proteobacteria   Taxonomy ID: 487   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Neisseria meningitidis

Experimental source:   Production method: in vitro transcription

Entity Sequences (FASTA):
RNA_(36-MER): GGAAUUUAUGAGUACCUUCG GAUACUUAUAGAUUCC

Data sets:
Data typeCount
13C chemical shifts76
15N chemical shifts17
1H chemical shifts215

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (36-MER)1

Entities:

Entity 1, RNA (36-MER) 36 residues - 11474.870 Da.

1   GGAAUUUAUG
2   AGUACCUUCG
3   GAUACUUAUA
4   GAUUCC

Samples:

sample_1: CssA4 (36mer)0.4 – 1.1 mM; CssA4 (36mer), 13C/15N-uniformly labeled, 0.4 – 1.1 mM; CssA4 (36mer), 13C/15N-AU labeled, 0.4 – 1.1 mM; CssA4 (36mer), partially deuterated, 0.4 – 1.1 mM; H2O 95%; D2O 5%

sample_conditions_1: pH: 6.0; pressure: 1 atm; temperature: 280 K

sample_conditions_2: pH: 6.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
ARTSYsample_1isotropicsample_conditions_1
ARTSYsample_1anisotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection, processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - peak picking, refinement, structure solution

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker Avance 600 MHz
  • Agilent INOVA 900 MHz

Related Database Links: