BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25671

Title: 1H Chemical Shift Assignments of the HIV ISS element   PubMed: 26607354

Authors: Tolbert, Blanton; Jain, Niyati; Morgan, Christopher; Rife, Brittany; Salemi, Marco

Citation: Jain, Niyati; Morgan, Christopher; Rife, Brittany; Salemi, Marco; Tolbert, Blanton. "Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1"  J. Biol. Chem. 291, 2331-2344 (2016).

Assembly members:
RNA_(53-MER), polymer, 53 residues, 17006.127 Da.

Natural source:   Common Name: HIV   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus Human immunodeficiency virus 1

Experimental source:   Production method: In vitro transcription   Host organism: T7 dependent In vitro Transcription

Entity Sequences (FASTA):
RNA_(53-MER): GGAAUAUUUUUGCUGUACUU UCUAUAGUGAAUAGAGUUAG GCAGGGAUAUUCC

Data sets:
Data typeCount
1H chemical shifts172

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (53-MER)1

Entities:

Entity 1, RNA (53-MER) 53 residues - 17006.127 Da.

1   GGAAUAUUUU
2   UGCUGUACUU
3   UCUAUAGUGA
4   AUAGAGUUAG
5   GCAGGGAUAU
6   UCC

Samples:

ISS_1: ISS (53-MER), [U-2H], 80 – 120 uM; D2O, natural abunance, 100%

ISS_2: ISS (53-MER), [U-2H], 80 – 120 uM; D2O, natural abunance, 100%

ISS_3: ISS (53-MER), [U-100% 13C], 80 – 120 uM; D2O, natural abunance, 100%

ISS_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYISS_1isotropicISS_conditions_1
2D 1H-1H TOCSYISS_2isotropicISS_conditions_1
2D 1H-13C HMQCISS_3isotropicISS_conditions_1

Software:

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution

TOPSPIN, Bruker Biospin - collection

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 500 MHz

Related Database Links: