BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25655

Title: NMR structure of the II-III-VI three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement   PubMed: 26124200

Authors: Bonneau, Eric; Girard, Nicolas; Lemieux, Sebastien; Legault, Pascale

Citation: Bonneau, Eric; Girard, Nicolas; Lemieux, Sebastien; Legault, Pascale. "The NMR structure of the II-III-VI three-way junction from the Neurospora VS ribozyme reveals a critical tertiary interaction and provides new insights into the global ribozyme structure"  RNA 21, 1621-1632 (2015).

Assembly members:
RNA_(62-MER), polymer, 62 residues, 20022.115 Da.
MAGNESIUM ION, non-polymer, 24.305 Da.
WATER, water, 18.015 Da.

Natural source:   Common Name: red bread mold   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(62-MER): GCAGCAGGGAACUCACGCUU GCGUAGAGGCUAAGUGCUUC GGCACAGCACAAGCCCGCUG CG

Data sets:
Data typeCount
13C chemical shifts394
15N chemical shifts51
1H chemical shifts511

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (62-MER)1
2MAGNESIUM ION_12
3MAGNESIUM ION_22
4MAGNESIUM ION_32
5MAGNESIUM ION_42
6MAGNESIUM ION_52
7MAGNESIUM ION_62
8MAGNESIUM ION_72
9MAGNESIUM ION_82
10water_13
11water_23
12water_33
13water_43
14water_53
15water_63
16water_73
17water_83
18water_93
19water_103
20water_113
21water_123
22water_133

Entities:

Entity 1, RNA (62-MER) 62 residues - 20022.115 Da.

1   GCAGCAGGGA
2   ACUCACGCUU
3   GCGUAGAGGC
4   UAAGUGCUUC
5   GGCACAGCAC
6   AAGCCCGCUG
7   CG

Entity 2, MAGNESIUM ION_1 - Mg - 24.305 Da.

1   MG

Entity 3, water_1 - 18.015 Da.

1   HOH

Samples:

J236-15N: RNA (62-MER), [U-15N], 2 mM; D2O 10%; H2O 90%; NaCacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

J236-13C-15N: RNA (62-MER), [U-13C; U-15N], 2 mM; D2O 100%; NaCacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

J236-ATP-13C-15N: RNA (62-MER), [U-13C; U-15N]-Ade, 2 mM; D2O 100%; NaCacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

J236-CTP-13C-15N: RNA (62-MER), [U-13C; U-15N]-Cyt, 2 mM; D2O 100%; NaCacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

J236-GTP-13C-15N: RNA (62-MER), [U-13C; U-15N]-Gua, 2.5 mM; D2O 100%; NaCacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

J236-13C-15N-H2O: RNA (62-MER), [U-13C; U-15N], 2 mM; D2O 10%; H2O 90%; NaCacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

Sample_condition_1: pH: 6.5; pressure: 1 atm; temperature: 273 K

Sample_condition_2: pH: 6.5; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
1D 1H watergateJ236-15NisotropicSample_condition_1
2D 1H-15N HSQCJ236-15NisotropicSample_condition_1
2D 1H-15N HSQC NH2 onlyJ236-15NisotropicSample_condition_1
2D HNN COSYJ236-15NisotropicSample_condition_1
2D 1H-1H NOESYJ236-15NisotropicSample_condition_1
2D 1H-15N CPMG-NOESYJ236-15NisotropicSample_condition_1
3D 15N-edited NOESY-HSQCJ236-15NisotropicSample_condition_1
3D 15N/13C-edited NOESY-HSQCJ236-13C-15N-H2OisotropicSample_condition_1
2D G-specific H(NC)-TOCSY-(C)HJ236-13C-15N-H2OisotropicSample_condition_1
2D A-specific H(NC)-TOCSY-(C)HJ236-13C-15N-H2OisotropicSample_condition_1
2D 1H-15N MQ-(HC)N(C)HJ236-13C-15NisotropicSample_condition_2
2D 1H-13C HSQCJ236-13C-15NisotropicSample_condition_2
2D 1H-13C HMQCJ236-13C-15NisotropicSample_condition_2
3D HCCH-COSYJ236-13C-15NisotropicSample_condition_2
3D HCCH-TOCSYJ236-13C-15NisotropicSample_condition_2
3D 13C-edited NOESY-HSQCJ236-13C-15NisotropicSample_condition_2
2D 1H-13C HSQCJ236-ATP-13C-15NisotropicSample_condition_2
2D 1H-13C HMQCJ236-ATP-13C-15NisotropicSample_condition_2
3D HCCH-COSYJ236-ATP-13C-15NisotropicSample_condition_2
3D HCCH-TOCSYJ236-ATP-13C-15NisotropicSample_condition_2
3D 13C-edited NOESY-HSQCJ236-ATP-13C-15NisotropicSample_condition_2
2D 1H-13C HSQCJ236-CTP-13C-15NisotropicSample_condition_2
2D 1H-13C HMQCJ236-CTP-13C-15NisotropicSample_condition_2
3D HCCH-COSYJ236-CTP-13C-15NisotropicSample_condition_2
3D HCCH-TOCSYJ236-CTP-13C-15NisotropicSample_condition_2
3D 13C-edited NOESY-HSQCJ236-CTP-13C-15NisotropicSample_condition_2
2D 1H-13C HSQCJ236-GTP-13C-15NisotropicSample_condition_2
2D 1H-13C HMQCJ236-GTP-13C-15NisotropicSample_condition_2
3D HCCH-COSYJ236-GTP-13C-15NisotropicSample_condition_2
3D HCCH-TOCSYJ236-GTP-13C-15NisotropicSample_condition_2
3D 13C-edited NOESY-HSQCJ236-GTP-13C-15NisotropicSample_condition_2

Software:

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing

CCPNMR, CCPN - chemical shift assignment, data analysis, peak picking

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Varian Unity 600 MHz

Related Database Links: