BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25652

Title: Structure of PTB RRM1(41-163) bound to an RNA stemloop containing a structured loop derived from viral internal ribosomal entry site RNA

Authors: Maris, Christophe; Jayne, Sandrine; Damberger, Fred; Ravindranathan, Sapna; Allain, Frederic

Citation: Maris, Christophe; Jayne, Sandrine; Damberger, Fred; Ravindranathan, Sapna; Allain, Frederic. "C-terminal helix folding upon pyrimidine-rich hairpin binding to PTB RRM1. Implications for PTB function in Encephalomyocarditis virus IRES activity."  To be Published ., .-..

Assembly members:
PTBRRM1, polymer, 123 residues, 13375.287 Da.
RNA_(5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), polymer, 23 residues, 7308.393 Da.

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
PTBRRM1: GNDSKKFKGDSRSAGVPSRV IHIRKLPIDVTEGEVISLGL PFGKVTNLLMLKGKNQAFIE MNTEEAANTMVNYYTSVTPV LRGQPIYIQFSNHKELKTDS SPNQARAQAALQAVNSVQSG NLA
RNA_(5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'): GGGACCUGGUCUUUCCAGGU CCC

Data sets:
Data typeCount
13C chemical shifts535
15N chemical shifts119
1H chemical shifts1013
residual dipolar couplings70

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1PTBRRM11
2RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3')2

Entities:

Entity 1, PTBRRM1 123 residues - 13375.287 Da.

1   GLYASNASPSERLYSLYSPHELYSGLYASP
2   SERARGSERALAGLYVALPROSERARGVAL
3   ILEHISILEARGLYSLEUPROILEASPVAL
4   THRGLUGLYGLUVALILESERLEUGLYLEU
5   PROPHEGLYLYSVALTHRASNLEULEUMET
6   LEULYSGLYLYSASNGLNALAPHEILEGLU
7   METASNTHRGLUGLUALAALAASNTHRMET
8   VALASNTYRTYRTHRSERVALTHRPROVAL
9   LEUARGGLYGLNPROILETYRILEGLNPHE
10   SERASNHISLYSGLULEULYSTHRASPSER
11   SERPROASNGLNALAARGALAGLNALAALA
12   LEUGLNALAVALASNSERVALGLNSERGLY
13   ASNLEUALA

Entity 2, RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 23 residues - 7308.393 Da.

1   GGGACCUGGU
2   CUUUCCAGGU
3   CCC

Samples:

15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; H2O 90%; D2O 10%

13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2O: PTBRRM1, [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; H2O 90%; D2O 10%

15N-PTBRRM1-13C-SL23H-RNA-in-D2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

15N-PTBRRM1-13C-ribose-labeled-U10U12U14-SL23H-RNA-in-D2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-13C; U-15N]-ribose-Ura10,Ura12,Ura14, 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

15N-PTBRRM1-unlabeled-SL23H-RNA-in-D2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-D2O: PTBRRM1, [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

15N-PTBRRM1-unlabeled-SL23H-RNA-Pf1-phage-in-H2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; Pf1 phage 13 mg/mL; H2O 90%; D2O 10%

15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-D2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; Pf1 phage 13 mg/mL; D2O 100%

15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-H2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; Pf1 phage 13 mg/mL; H2O 90%; D2O 10%

15N-PTBRRM1-13C15N-SL23H-RNA-in-H2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; H2O 90%; D2O 10%

15N-PTBRRM1-13C-ribose-labeled-G9U11U13C15-SL23H-RNA-in-D2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-13C; U-15N]-ribose-Cyt9,Ura11,Ura13,Gua15, 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

15N-PTBRRM1-13C-labeled-CU-SL23H-RNA-in-D2O: PTBRRM1, [U-99% 15N], 1 ± 0.2 mM; RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-13C; U-15N]-Ura7,Ura10,Cyt11,Ura12,Ura13,Ura14,Cyt15,Cyt16,Ura20,Cyt21,Cyt22,Cyt23, 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

13C-SL23H-RNA-in-D2O: RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3'), [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; D2O 100%

unlabeled-SL23H-RNA-in-H2O: RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP*CP*UP*UP*UP*CP*CP*AP*GP*GP*UP*CP*CP*C)-3') 1 ± 0.2 mM; sodium phosphate 10 ± 0.1 mM; sodium chloride 20 ± 0.2 mM; H2O 90%; D2O 10%

40C: ionic strength: 0.020 M; pH: 6.5; pressure: 1 atm; temperature: 313 K

25C: ionic strength: 0.020 M; pH: 6.5; pressure: 1 atm; temperature: 298 K

5C: ionic strength: 0.020 M; pH: 6.5; pressure: 1 atm; temperature: 278 K

30C: ionic strength: 0.020 M; pH: 6.5; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
3D HNCA13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D HN(CO)CA13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D HNCACB13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D HNCO13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D H(C)CH-TOCSY13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D (H)CCH-TOCSY13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D 1H-15N NOESY-HSQC15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D 1H-13C NOESY aliphatic-HSQC13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
3D 1H-13C NOESY aromatic-HSQC13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
2D 1H-1H TOCSY15N-PTBRRM1-unlabeled-SL23H-RNA-in-D2Oisotropic40C
2D 1H-1H NOESY15N-PTBRRM1-unlabeled-SL23H-RNA-in-D2Oisotropic40C
3D f1-13Cfiltered,f2-13C-edited NOESY aliphatic-HSQC15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
3D f1-13Cfiltered,f2-13C-edited NOESY aliphatic-HSQC15N-PTBRRM1-13C-ribose-labeled-U10U12U14-SL23H-RNA-in-D2Oisotropic40C
2D f2-13C-filtered NOESY15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
3D aliphatic-HSQC-NOESY13C15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic5C
2D H2C2 TROSY15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
2D H6C6 TROSY15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
2D H8C8 TROSY15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
2D H2C2 TROSY15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-D2Oanisotropic40C
2D H6C6 TROSY15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-D2Oanisotropic40C
2D H8C8 TROSY15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-D2Oanisotropic40C
2D H5C5 TROSY15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
2D H1'C1' TROSY15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
2D H5C5 TROSY15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-D2Oanisotropic40C
2D H1'C1' TROSY15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-D2Oanisotropic40C
2D HN TROSY15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
2D HN TROSY15N-PTBRRM1-unlabeled-SL23H-RNA-Pf1-phage-in-H2Oanisotropic40C
2D HN TROSY15N-PTBRRM1-13C15N-SL23H-RNA-in-H2Oisotropic5C
2D HN TROSY15N-PTBRRM1-13C15N-SL23H-RNA-Pf1-phage-in-H2Oanisotropic5C
2D {1H}15N-NOE HSQC15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic40C
2D 1H-1H NOESY15N-PTBRRM1-unlabeled-SL23H-RNA-in-H2Oisotropic5C
3D f1-13Cfiltered,f2-13C-edited NOESY aliphatic-HSQC15N-PTBRRM1-13C-labeled-CU-SL23H-RNA-in-D2Oisotropic40C
3D 1H-13C NOESY aliphatic15N-PTBRRM1-13C-labeled-CU-SL23H-RNA-in-D2Oisotropic40C
3D 1H-13C NOESY aliphatic15N-PTBRRM1-13C-ribose-labeled-U10U12U14-SL23H-RNA-in-D2Oisotropic40C
3D f1-13Cfiltered,f2-13C-edited NOESY aliphatic-HSQC15N-PTBRRM1-13C-ribose-labeled-G9U11U13C15-SL23H-RNA-in-D2Oisotropic40C
2D 1H-13C HSQC aliphatic15N-PTBRRM1-13C-ribose-labeled-U10U12U14-SL23H-RNA-in-D2Oisotropic40C
2D 1H-13C HSQC aromatic15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
3D 1H-13C NOESY aliphatic15N-PTBRRM1-13C-SL23H-RNA-in-D2Oisotropic40C
3D 1H-13C NOESY aromatic15N-PTBRRM1-unlabeled-SL23H-RNA-in-D2Oisotropic40C
3D 1H-13C NOESY aliphatic13C-SL23H-RNA-in-D2Oisotropic30C
3D 1H-13C NOESY aromatic13C-SL23H-RNA-in-D2Oisotropic30C
2D 1H-13C HSQC aliphatic15N-PTBRRM1-13C-ribose-labeled-G9U11U13C15-SL23H-RNA-in-D2Oisotropic40C
2D 1H-1H NOESYunlabeled-SL23H-RNA-in-H2Oisotropic5C

Software:

SPARKY v3.114, Goddard - chemical shift assignment, peak picking

UNIO/ATNOS-CANDID v10, Herrmann, Guntert and Wuthrich - NOE assignment, peak picking

CYANA v3.0, Guntert, Mumenthaler and Wuthrich - NOE assignment, chemical shift assignment, structure calculation

AMBER v12, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure refinement

ProcheckNMR v3.5.4, Laskowski and MacArthur - validation

Molmol v2K.2, Koradi, Billeter and Wuthrich - data analysis

NMR spectrometers:

  • Bruker Avance 500 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 750 MHz
  • Bruker Avance 900 MHz

Related Database Links:

UNP K7ES59