BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25571

Title: HIV-1 Core Packaging Signal   PubMed: 25999508

Authors: Keane, Sarah; Summers, Michael

Citation: Keane, Sarah; Heng, Xiao; Lu, Kun; Kharytonchyk, Siarhei; Ramakrishnan, Venkateswaran; Carter, Gregory; Barton, Shawn; Hosic, Azra; Florwick, Alyssa; Santos, Justin; Bolden, Nicholas; McCowin, Sayo; Case, David; Johnson, Bruce; Salemi, Marco; Telesnitsky, Alice; Summers, Michael. "RNA structure. Structure of the HIV-1 RNA packaging signal"  Science 348, 917-921 (2015).

Assembly members:
RNA_(155-MER), polymer, 155 residues, 50544.359 Da.

Natural source:   Common Name: AIDS virus   Taxonomy ID: 12721   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus Human immunodeficiency virus

Experimental source:   Production method: enzymatic semisynthesis   Host organism: HIV

Entity Sequences (FASTA):
RNA_(155-MER): GGUGCCCGUCUGUUGUGUGA CUCUGGUGAGAGCCAGAGGA GAUCUCUCGACGCAGGACUC GGCUUGCUGGAGACGGCAAG AGGCGAGGGGCGGCGACUGG UGAGUACGCCAAAAAUUUUG ACUAGCGGAGGCUAGAAGGA GAGAGAUGGGUGCCC

Data sets:
Data typeCount
1H chemical shifts695

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (155-MER)1

Entities:

Entity 1, RNA (155-MER) 155 residues - 50544.359 Da.

1   GGUGCCCGUC
2   UGUUGUGUGA
3   CUCUGGUGAG
4   AGCCAGAGGA
5   GAUCUCUCGA
6   CGCAGGACUC
7   GGCUUGCUGG
8   AGACGGCAAG
9   AGGCGAGGGG
10   CGGCGACUGG
11   UGAGUACGCC
12   AAAAAUUUUG
13   ACUAGCGGAG
14   GCUAGAAGGA
15   GAGAGAUGGG
16   UGCCC

Samples:

ACGU: RNA (155-MER) 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A: RNA (155-MER), A-H, C-D, G-D, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

G: RNA (155-MER), A-D, C-D, G-H, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

C: RNA (155-MER), A-D, C-H, G-D, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

U6r: RNA (155-MER), A-D, C-D, G-D, U-5D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2rGr: RNA (155-MER), A-8D, C-D, G-8D, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2rCr: RNA (155-MER), A-8D, C-5,6-D2, G-D, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2rUr: RNA (155-MER), A-8D, C-D, G-D, U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2rGrCr: RNA (155-MER), A-8D, C-5,6-D2, G-8D, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2rGrUr: RNA (155-MER), A-8D, C-D, G-8D, U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2rCrUr: RNA (155-MER), A-8D, C-5,6-D2, G-D, U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2Ur: RNA (155-MER), A-8,1',2',3',4',5',5 -D7, C-D, G-D, U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

A2GrUr: RNA (155-MER), A-8,1',2',3',4',5',5 -D7, C-D, G-8D, U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

AG8: RNA (155-MER), A-H, C-D, G-1',2',3',4',5',5''-D6 , U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

GA8: RNA (155-MER), A-2,1',2',3',4',5',5-D7, C-D, G-H, U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

UA8: RNA (155-MER), A-2,1',2',3',4',5',5-D7, C-D, G-D, U-H, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

GUr: RNA (155-MER), A-D, C-D, G-H, U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

G8Ur: RNA (155-MER), A-D, C-D, G-1',2',3',4',5',5''-D6 , U-5,6-D2, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

G8U6r: RNA (155-MER), A-D, C-D, G-1',2',3',4',5',5''-D6 , U-5D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

G8C6r: RNA (155-MER), A-D, C-5D, G-1',2',3',4',5',5''-D6 , U-D, 300 mM; TRIS, [U-2H], 20 mM; D2O 100%

sample_conditions_1: ionic strength: 20 mM; pD: 7.5 pD; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYACGUisotropicsample_conditions_1
2D 1H-1H NOESYAisotropicsample_conditions_1
2D 1H-1H NOESYGisotropicsample_conditions_1
2D 1H-1H NOESYCisotropicsample_conditions_1
2D 1H-1H NOESYU6risotropicsample_conditions_1
2D 1H-1H NOESYA2rGrisotropicsample_conditions_1
2D 1H-1H NOESYA2rCrisotropicsample_conditions_1
2D 1H-1H NOESYA2rUrisotropicsample_conditions_1
2D 1H-1H NOESYA2rGrCrisotropicsample_conditions_1
2D 1H-1H NOESYA2rGrUrisotropicsample_conditions_1
2D 1H-1H NOESYA2rCrUrisotropicsample_conditions_1
2D 1H-1H NOESYA2Urisotropicsample_conditions_1
2D 1H-1H NOESYA2GrUrisotropicsample_conditions_1
2D 1H-1H NOESYAG8isotropicsample_conditions_1
2D 1H-1H NOESYGA8isotropicsample_conditions_1
2D 1H-1H NOESYUA8isotropicsample_conditions_1
2D 1H-1H NOESYGUrisotropicsample_conditions_1
2D 1H-1H NOESYG8Urisotropicsample_conditions_1
2D 1H-1H NOESYG8U6risotropicsample_conditions_1
2D 1H-1H NOESYG8C6risotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis, peak picking

CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization, structure solution

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker Avance 600 MHz

Related Database Links: