BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25163

Title: NMR structure of the III-IV-V three-way junction from the VS ribozyme   PubMed: 25238589

Authors: Bonneau, Eric; Legault, Pascale

Citation: Bonneau, Eric; Legault, Pascale. "Nuclear Magnetic Resonance Structure of the III-IV-V Three-Way Junction from the Varkud Satellite Ribozyme and Identification of Magnesium-Binding Sites Using Paramagnetic Relaxation Enhancement."  Biochemistry 53, 6264-6275 (2014).

Assembly members:
RNA_(47-MER), polymer, 47 residues, 15118.061 Da.

Natural source:   Common Name: ascomycetes   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(47-MER): GGACCUCCCGUCCUUGGACG GUCGAGCGAAAGCUUGUGAU UGGUCCG

Data sets:
Data typeCount
1H chemical shifts368
13C chemical shifts286
15N chemical shifts39

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (47-MER)1

Entities:

Entity 1, RNA (47-MER) 47 residues - 15118.061 Da.

1   GGACCUCCCG
2   UCCUUGGACG
3   GUCGAGCGAA
4   AGCUUGUGAU
5   UGGUCCG

Samples:

J345-1: J345-1, [U-100% 15N], 1.5 – 2.0 mM; KCl 50 mM; MgCl2 5 mM; H2O 90%; D2O 10%

J345-2: J345-2, [U-100% 13C; U-100% 15N], 2.0 mM; KCl 50 mM; MgCl2 5 mM; D2O 100%

J345-3: J345-3, [U-100% 13C; U-100% 15N], 2.0 mM; KCl 50 mM; MgCl2 5 mM; H2O 90%; D2O 10%

sample_conditions_1: temperature: 288 K; pH: 6.5; ionic strength: 55 mM

sample_conditions_2: temperature: 298 K; pH: 6.5; ionic strength: 55 mM

Experiments:

NameSampleSample stateSample conditions
1D flip-back watergate 1HJ345-1isotropicsample_conditions_1
2D 1H-15N HSQCJ345-1isotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlyJ345-1isotropicsample_conditions_1
3D 1H-15N NOESYJ345-1isotropicsample_conditions_1
2D 1H-13C HSQCJ345-2isotropicsample_conditions_2
3D 13C-edited HMQC-NOESYJ345-2isotropicsample_conditions_2
3D CT-HCCH-COSYJ345-2isotropicsample_conditions_2
3D HCCH-TOCSYJ345-2isotropicsample_conditions_2
3D 15N-edited NOESY-HSQCJ345-3isotropicsample_conditions_2
2D H(NC)-TOCSY-(C)H for guanosine residuesJ345-3isotropicsample_conditions_2
2D 1H-13C HMQCJ345-2isotropicsample_conditions_2
2D 1H-15N MQ-(HC)N(C)HJ345-2isotropicsample_conditions_2
2D 1H-15N CPMG-NOESYJ345-1isotropicsample_conditions_1
2D HNN-COSYJ345-1isotropicsample_conditions_1

Software:

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, processing

CCPNMR_suite, CCPN - chemical shift assignment, data analysis, peak picking

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution, refinement

PyMol, Schrodinger - Structure analysis, Structure display

NMR spectrometers:

  • Varian Unity 600 MHz

Related Database Links: