BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25100

Title: Solution NMR structure pf tRNApro:MLV-Nucleocapsid (1:2) Complex   PubMed: 25209668

Authors: D'Souza, Victoria; Yildiz, Zehra

Citation: Miller, Sarah; Yildiz, F.; Lo, Jennifer; Wang, Bo; D'Souza, Victoria. "A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing"  Nature 515, 591-595 (2014).

Assembly members:
MLV_Nucleocapsid, polymer, 55 residues, Formula weight is not available
RNA_(71-MER), polymer, 74 residues, Formula weight is not available
ZINC ION, non-polymer, 65.409 Da.

Natural source:   Common Name: Murine Leukemia Virus   Taxonomy ID: 11786   Superkingdom: not available   Kingdom: not available   Genus/species: Gammaretrovirus not available

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
MLV_Nucleocapsid: ATVVSGQKQDRQGGERRRSQ LDRDQCAYCKEKGHWAKDCP KKPRGPRGPRPQTSL
RNA_(71-MER): GGCUCGUUGGUCUAGGGGUA UGAUUCUCGCUUAGGGUGCG AGAGGUCCCGGGUUCAAAUC CCGGACGAGCCCCA

Data typeCount
13C chemical shifts33
1H chemical shifts303

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2RNA (71-MER), 12
3RNA (71-MER), 22
4ZINC ION_13
5ZINC ION_23

Entities:

Entity 1, entity_1 55 residues - Formula weight is not available

1   ALATHRVALVALSERGLYGLNLYSGLNASP
2   ARGGLNGLYGLYGLUARGARGARGSERGLN
3   LEUASPARGASPGLNCYSALATYRCYSLYS
4   GLULYSGLYHISTRPALALYSASPCYSPRO
5   LYSLYSPROARGGLYPROARGGLYPROARG
6   PROGLNTHRSERLEU

Entity 2, RNA (71-MER), 1 74 residues - Formula weight is not available

1   GGCUCGUUGG
2   UCUAGGGGUA
3   UGAUUCUCGC
4   UUAGGGUGCG
5   AGAGGUCCCG
6   GGUUCAAAUC
7   CCGGACGAGC
8   CCCA

Entity 3, ZINC ION_1 - Zn - 65.409 Da.

1   ZN

Samples:

sample_1: NC-tRNApro (1:1) 0.5 mM; MgCl2 1 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%

sample_2: NC-tRNApro (1:1), 13C, 15N G-lab tRNA-pro, 0.5 mM; MgCl2 1 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%

sample_3: NC-tRNApro (1:1), 13C, 15N G-lab tRNA-pro, 0.5 mM; MgCl2 1 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%

sample_conditions_1: pH: 7.2; pressure: 1 atm; temperature: 311 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-13N HSQCsample_3isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_3isotropicsample_conditions_1
2D NOESYnot availableisotropicsample_conditions_1

Software:

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax, Johnson, One Moon Scientific - data analysis, processing, refinement

NMR spectrometers:

  • Bruker DMX 700 MHz

Related Database Links:

BMRB 25052 25101
PDB
GB AAB59942 AAB64159 AAC82566 AAC82568 AAL69908
PRF 0711245A
REF NP_057933 NP_057934 NP_955586
SP P03332 P03355 Q8UN02