BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25052

Title: A structure-based mechanism for tRNA and retroviral RNA remodeling during primer annealing   PubMed: 25209668

Authors: D'Souza, Victoria; Yildiz, Zehra

Citation: Miller, Sarah; Yildiz, F.; Lo, Jennifer; Wang, Bo; D'Souza, Victoria. "A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing"  Nature 515, 591-595 (2014).

Assembly members:
entity_1, polymer, 56 residues, 6377.297 Da.
RNA_(68-MER), polymer, 68 residues, 21894.025 Da.

Natural source:   Common Name: Murine Leukemia Virus   Taxonomy ID: 11786   Superkingdom: not available   Kingdom: not available   Genus/species: Gammaretrovirus not available

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
entity_1: ATVVSGQKQDRQGGERRRSQ LDRDQCAYCKEKGHWAKDCP KKPRGPRGPRPQTSLL
RNA_(68-MER): GGGCGAGGGUCUCCUCUGAG UGAUUGACUACCCGUCAGCG GGGGUCUUUCAUUUGGGGGC UCGUGCCC

Data typeCount
1H chemical shifts252

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2RNA (68-MER)2

Entities:

Entity 1, entity_1 56 residues - 6377.297 Da.

1   ALATHRVALVALSERGLYGLNLYSGLNASP
2   ARGGLNGLYGLYGLUARGARGARGSERGLN
3   LEUASPARGASPGLNCYSALATYRCYSLYS
4   GLULYSGLYHISTRPALALYSASPCYSPRO
5   LYSLYSPROARGGLYPROARGGLYPROARG
6   PROGLNTHRSERLEULEU

Entity 2, RNA (68-MER) 68 residues - 21894.025 Da.

1   GGGCGAGGGU
2   CUCCUCUGAG
3   UGAUUGACUA
4   CCCGUCAGCG
5   GGGGUCUUUC
6   AUUUGGGGGC
7   UCGUGCCC

Samples:

sample_1-U5-PBS: U5-PBS-NC, 15N,13C-Alab, 0.5 mM; U5-PBS-NC, 15N,13C-Glab, 0.5 mM; U5-PBS-NC, 15N,13C-Ulab, 0.5 mM; U5-PBS-NC, 15N,13C-Clab, 0.5 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%

sample_2-U5-PBS-M2: U5-PBS-M2-NC 0.5 mM; NaCl 10 mM; Tris 10 mM; D2O 100%

sample_3-linker: UAUCG-linker 1 mM; NaCl 10 mM; Tris 10 mM; D2O 100%

sample_conditions_1: pH: 7.0; pressure: 1 atm; temperature: 311 K

sample_conditions_2: pH: 7.0; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1-U5-PBSisotropicsample_conditions_1
2D 1H-13C HSQCsample_1-U5-PBSisotropicsample_conditions_1
2D 1H-1H NOESYsample_2-U5-PBS-M2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3-linkerisotropicsample_conditions_2
3D 1H-13C NOESYsample_1-U5-PBSisotropicsample_conditions_1

Software:

CYANA, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax, Guntert, Mumenthaler and Wuthrich, Johnson, One Moon Scientific - data analysis, processing, refinement

NMR spectrometers:

  • Bruker DMX 700 MHz

Related Database Links:

BMRB 25100 25101
PDB
GB AAB59942 AAB64159 AAC82566 AAC82568 AAL69908
PRF 0711245A
REF NP_057933 NP_057934 NP_955586
SP P03332 P03355 Q8UN02