BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25049

Title: A Structure based mechanism for tRNA and retroviral RNA remodeling during primer annealing   PubMed: 25209668

Authors: D'Souza, Victoria; Yildiz, Zehra

Citation: Miller, Sarah; Yildiz, F.; Lo, Jennifer; Wang, Bo; D'Souza, Victoria. "A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing"  Nature 515, 591-595 (2014).

Assembly members:
RNA_(68-MER), polymer, 68 residues, 21894.025 Da.

Natural source:   Common Name: Murine Leukemia Virus   Taxonomy ID: 11786   Superkingdom: Viruses   Kingdom: not available   Genus/species: Gammaretrovirus not available

Experimental source:   Production method: recombinant technology   Host organism: in vitro transcription

Entity Sequences (FASTA):
RNA_(68-MER): GGGCGAGGGUCUCCUCUGAG UGAUUGACUACCCGUCAGCG GGGGUCUUUCAUUUGGGGGC UCGUGCCC

Data typeCount
13C chemical shifts296
15N chemical shifts27
1H chemical shifts397

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (68-MER)1

Entities:

Entity 1, RNA (68-MER) 68 residues - 21894.025 Da.

1   GGGCGAGGGU
2   CUCCUCUGAG
3   UGAUUGACUA
4   CCCGUCAGCG
5   GGGGUCUUUC
6   AUUUGGGGGC
7   UCGUGCCC

Samples:

sample_1: U5-PBS, [U-100% 13C; U-100% 15N], 0.8 mM; Tris 10 mM; NaCl 10 mM; D2O 100%

sample_conditions_1: ionic strength: 20 mM; pH: 7.2; pressure: 1 atm; temperature: 311 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYin H2Osample_1isotropicsample_conditions_1
2D 1H-1H NOESYin D2Osample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1

Software:

CYANA, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax, Guntert, Mumenthaler and Wuthrich, Johnson, One Moon Scientific - data analysis, processing, structure solution

NMR spectrometers:

  • Bruker DMX 700 MHz

Related Database Links: