BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19887

Title: oligonucleotide model of miR-21 pre-element   PubMed: 25250627

Authors: Chirayil, Sara; Wu, Qiong; Amezcua, Carlos; Luebke, Kevin

Citation: Chirayil, Sara; Wu, Qiong; Amezcua, Carlos; Luebke, Kevin. "NMR Characterization of an Oligonucleotide Model of the MiR-21 Pre-Element"  PLOS ONE 9, e108231-e108231 (2014).

Assembly members:
miR-21_pre-element, polymer, 29 residues, 111.103 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: obtained from a vendor

Entity Sequences (FASTA):
miR-21_pre-element: GGGUUGACCGUUGAAUCUCA CGGCAACCC

Data sets:
Data typeCount
1H chemical shifts100

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1miR-21 pre-element1

Entities:

Entity 1, miR-21 pre-element 29 residues - 111.103 Da.

1   GGGUUGACCG
2   UUGAAUCUCA
3   CGGCAACCC

Samples:

sample_1: miR-21 pre-element 1 mM; H2O 90%; D2O 10%

sample_conditions_1: temperature: 273 K; pH: 6.7; pressure: 1 atm; ionic strength: 10 mM

Experiments:

NameSampleSample stateSample conditions
2D DQF-COSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1

Software:

CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: