BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19805

Title: 13C and 15N Chemical Shift Assignments for the dsDNA in Bacteriophage T7   PubMed: 24875850

Authors: Goldbourt, Amir; Abramov, Gili

Citation: Goldbourt, Amir; Abramov, Gili. "Nucleotide-type chemical shift assignment of the encapsulated 40 kbp dsDNA in intact bacteriophage T7 by MAS solid-state NMR"  J. Biomol. NMR 59, 219-230 (2014).

Assembly members:
T7_dsDNA, polymer, 39937 residues, Formula weight is not available

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: purified from the natural source   Host organism: Escherichia coli

Entity Sequences (FASTA):
T7_dsDNA: TCTCACAGTGTACGGACCTA AAGTTCCCCCATAGGGGGTA CCTAAAGCCCAGCCAATCAC CTAAAGTCAACCTTCGGTTG ACCTTGAGGGTTCCCTAAGG GTTGGGGATGACCCTTGGGT TTGTCTTTGGGTGTTACCTT GAGTGTCTCTCTGTGTCCCT ATCTGTTACAGTCTCCTAAA GTATCCTCCTAAAGTCACCT CCTAACGTCCATCCTAAAGC CAACACCTAAAGCCTACACC TAAAGACCCATCAAGTCAAC GCCTATCTTAAAGTTTAAAC ATAAAGACCAGACCTAAAGA CCAGACCTAAAGACACTACA TAAAGACCAGACCTAAAGAC GCCTTGTTGTTAGCCATAAA GTGATAACCTTTAATCATTG TCTTTATTAATACAACTCAC TATAAGGAGAGACAACTTAA AGAGACTTAAAAGATTAATT TAAAATTTATCAAAAAGAGT ATTGACTTAAAGTCTAACCT ATAGGATACTTACAGCCATC GAGAGGGACACGGCGAATAG CCATCCCAATCGACACCGGG GTCAACCGGATAAGTAGACA GCCTGATAAGTCGCACGAAA AACAGGTATTGACAACATGA AGTAACATGCAGTAAGATAC AAATCGCTAGGTAACACTAG CAGCGTCAACCGGGCGCACA GTGCCTTCTAGGTGACTTAA GCGCACCACGGCACATAAGG TGAAACAAAACGGTTGACAA CATGAAGTAAACACGGTACG ATGTACCACATGAAACGACA GTGAGTCACCACACTGAAAG GTGATGCGGTCTAACGAAAC CTGACCTAAGACGCTCTTTA ACAATCTGGTAAATAGCTCT TGAGTGCATGACTAGCGGAT AACTCAAGGGTATCGCAAGG TGCCCTTTATGATATTCACT AATAACTGCACGAGGTAACA CAAGATGGCTATGTCTAACA TGACTTACAACAACGTTTTC GACCACGCTTACGAAATGCT GAAAGAAAACATCCGTTATG ATGACATCCGTGACACTGAT GACCTGCACGATGCTATTCA CATGGCTGCCGATAATGCAG TTCCGCACTACTACGCTGAC ATCTTTAGCGTAATGGCAAG TGAGGGCATTGACCTTGAGT TCGAAGACTCTGGTCTGATG CCTGACACCAAGGACGTAAT CCGCATCCTGCAAGCGCGTA TCTATGAGCAATTAACGATT GACCTCTGGGAAGACGCAGA AGACTTGCTCAATGAATACT TGGAGGAAGTCGAGGAGTAC GAGGAGGATGAAGAGTAATG TCTACTACCAACGTGCAATA CGGTCTGACCGCTCAAACTG TACTTTTCTATAGCGACATG GTGCGCTGTGGCTTTAACTG GTCACTCGCAATGGCACAGC TCAAAGAACTGTACGAAAAC AACAAGGCAATAGCTTTAGA ATCTGCTGAGTGATAGACTC AAGGTCGCTCCTAGCGAGTG GCCTTTATGATTATCACTTT ACTTATGAGGGAGTAATGTA TATGCTTACTATCGGTCTAC TCACCGCTCTAGGTCTAGCT GTAGGTGCATCCTTTGGGAA GGCTTTAGGTGTAGCTGTAG GTTCCTACTTTACCGCTTGC ATCATCATAGGAATCATCAA AGGGGCACTACGCAAATGAT GAAGCACTACGTTATGCCAA TCCACACGTCCAACGGGGCA ACCGTATGTACACCTGATGG GTTCGCAATGAAACAACGAA TCGAACGCCTTAAGCGTGAA CTCCGCATTAACCGCAAGAT TAACAAGATAGGTTCCGGCT ATGACAGAACGCACTGATGG CTTAAAGAAAGGTTATATGC CCAATGGCACACTATACGCT GCAAATCGGCGAATAGTGAG AACTTGGCGAGAGAACAACC TCGAACGCCGCAAGGACAAG AGAGGGCGGCGTGGCATAGA CGAAAGGAAAAGGTTAAAGC CAAGAAACTCGCCGCACTTG AACAGGCACTAGCCAACACA CTGAACGCTATCTCATAACG AACATAAAGGACACAATGCA ATGAACATTACCGACATCAT GAACGCTATCGACGCAATCA AAGCACTGCCAATCTGTGAA CTTGACAAGCGTCAAGGTAT GCTTATCGACTTACTGGTCG AGATGGTCAACAGCGAGACG TGTGATGGCGAGCTAACCGA ACTAAATCAGGCACTTGAGC ATCAAGATTGGTGGACTACC TTGAAGTGTCTCACGGCTGA CGCAGGGTTCAAGATGCTCG GTAATGGTCACTTCTCGGCT GCTTATAGTCACCCGCTGCT ACCTAACAGAGTGATTAAGG TGGGCTTTAAGAAAGAGGAT TCAGGCGCAGCCTATACCGC ATTCTGCCGCATGTATCAGG GTCGTCCTGGTATCCCTAAC GTCTACGATGTACAGCGCCA CGCTGGATGCTATACGGTGG TACTTGACGCACTTAAGGAT TGCGAGCGTTTCAACAATGA TGCCCATTATAAATACGCTG AGATTGCAAGCGACATCATT GATTGCAATTCGGATGAGCA TGATGAGTTAACTGGATGGG ATGGTGAGTTTGTTGAAACT TGTAAACTAATCCGCAAGTT CTTTGAGGGCATCGCCTCAT TCGACATGCATAGCGGGAAC ATCATGTTCTCAAATGGAGA CGTACCATACATCACCGACC CGGTATCATTCTCGCAGAAG AAAGACGGTGGCGCATTCAG CATCGACCCTGAGGAACTCA TCAAGGAAGTCGAGGAAGTC GCACGACAGAAAGAAATTGA CCGCGCTAAGGCCCGTAAAG AACGTCACGAGGGGCGCTTA GAGGCACGCAGATTCAAACG TCGCAACCGCAAGGCACGTA AAGCACACAAAGCTAAGCGC GAAAGAATGCTTGCTGCGTG GCGATGGGCTGAACGTCAAG AACGGCGTAACCATGAGGTA GCTGTAGATGTACTAGGAAG AACCAATAACGCTATGCTCT GGGTCAACATGTTCTCTGGG GACTTTAAGGCGCTTGAGGA ACGAATCGCGCTGCACTGGC GTAATGCTGACCGGATGGCT ATCGCTAATGGTCTTACGCT CAACATTGATAAGCAACTTG ACGCAATGTTAATGGGCTGA TAGTCTTATCTTACAGGTCA TCTGCGGGTGGCCTGAATAG GTACGATTTACTAACTGGAA GAGGCACTAAATGAACACGA TTAACATCGCTAAGAACGAC TTCTCTGACATCGAACTGGC TGCTATCCCGTTCAACACTC TGGCTGACCATTACGGTGAG CGTTTAGCTCGCGAACAGTT GGCCCTTGAGCATGAGTCTT ACGAGATGGGTGAAGCACGC TTCCGCAAGATGTTTGAGCG TCAACTTAAAGCTGGTGAGG TTGCGGATAACGCTGCCGCC AAGCCTCTCATCACTACCCT ACTCCCTAAGATGATTGCAC GCATCAACGACTGGTTTGAG GAAGTGAAAGCTAAGCGCGG CAAGCGCCCGACAGCCTTCC AGTTCCTGCAAGAAATCAAG CCGGAAGCCGTAGCGTACAT CACCATTAAGACCACTCTGG CTTGCCTAACCAGTGCTGAC AATACAACCGTTCAGGCTGT AGCAAGCGCAATCGGTCGGG CCATTGAGGACGAGGCTCGC TTCGGTCGTATCCGTGACCT TGAAGCTAAGCACTTCAAGA AAAACGTTGAGGAACAACTC AACAAGCGCGTAGGGCACGT CTACAAGAAAGCATTTATGC AAGTTGTCGAGGCTGACATG CTCTCTAAGGGTCTACTCGG TGGCGAGGCGTGGTCTTCGT GGCATAAGGAAGACTCTATT CATGTAGGAGTACGCTGCAT CGAGATGCTCATTGAGTCAA CCGGAATGGTTAGCTTACAC CGCCAAAATGCTGGCGTAGT AGGTCAAGACTCTGAGACTA TCGAACTCGCACCTGAATAC GCTGAGGCTATCGCAACCCG TGCAGGTGCGCTGGCTGGCA TCTCTCCGATGTTCCAACCT TGCGTAGTTCCTCCTAAGCC GTGGACTGGCATTACTGGTG GTGGCTATTGGGCTAACGGT CGTCGTCCTCTGGCGCTGGT GCGTACTCACAGTAAGAAAG CACTGATGCGCTACGAAGAC GTTTACATGCCTGAGGTGTA CAAAGCGATTAACATTGCGC AAAACACCGCATGGAAAATC AACAAGAAAGTCCTAGCGGT CGCCAACGTAATCACCAAGT GGAAGCATTGTCCGGTCGAG GACATCCCTGCGATTGAGCG TGAAGAACTCCCGATGAAAC CGGAAGACATCGACATGAAT CCTGAGGCTCTCACCGCGTG GAAACGTGCTGCCGCTGCTG TGTACCGCAAGGACAAGGCT CGCAAGTCTCGCCGTATCAG CCTTGAGTTCATGCTTGAGC AAGCCAATAAGTTTGCTAAC CATAAGGCCATCTGGTTCCC TTACAACATGGACTGGCGCG GTCGTGTTTACGCTGTGTCA ATGTTCAACCCGCAAGGTAA CGATATGACCAAAGGACTGC TTACGCTGGCGAAAGGTAAA CCAATCGGTAAGGAAGGTTA CTACTGGCTGAAAATCCACG GTGCAAACTGTGCGGGTGTC GATAAGGTTCCGTTCCCTGA GCGCATCAAGTTCATTGAGG AAAACCACGAGAACATCATG GCTTGCGCTAAGTCTCCACT GGAGAACACTTGGTGGGCTG AGCAAGATTCTCCGTTCTGC TTCCTTGCGTTCTGCTTTGA GTACGCTGGGGTACAGCACC ACGGCCTGAGCTATAACTGC TCCCTTCCGCTGGCGTTTGA CGGGTCTTGCTCTGGCATCC AGCACTTCTCCGCGATGCTC CGAGATGAGGTAGGTGGTCG CGCGGTTAACTTGCTTCCTA GTGAAACCGTTCAGGACATC TACGGGATTGTTGCTAAGAA AGTCAACGAGATTCTACAAG CAGACGCAATCAATGGGACC GATAACGAAGTAGTTACCGT GACCGATGAGAACACTGGTG AAATCTCTGAGAAAGTCAAG CTGGGCACTAAGGCACTGGC TGGTCAATGGCTGGCTTACG GTGTTACTCGCAGTGTGACT AAGCGTTCAGTCATGACGCT GGCTTACGGGTCCAAAGAGT TCGGCTTCCGTCAACAAGTG CTGGAAGATACCATTCAGCC AGCTATTGATTCCGGCAAGG GTCTGATGTTCACTCAGCCG AATCAGGCTGCTGGATACAT GGCTAAGCTGATTTGGGAAT CTGTGAGCGTGACGGTGGTA GCTGCGGTTGAAGCAATGAA CTGGCTTAAGTCTGCTGCTA AGCTGCTGGCTGCTGAGGTC AAAGATAAGAAGACTGGAGA GATTCTTCGCAAGCGTTGCG CTGTGCATTGGGTAACTCCT GATGGTTTCCCTGTGTGGCA GGAATACAAGAAGCCTATTC AGACGCGCTTGAACCTGATG TTCCTCGGTCAGTTCCGCTT ACAGCCTACCATTAACACCA ACAAAGATAGCGAGATTGAT GCACACAAACAGGAGTCTGG TATCGCTCCTAACTTTGTAC ACAGCCAAGACGGTAGCCAC CTTCGTAAGACTGTAGTGTG GGCACACGAGAAGTACGGAA TCGAATCTTTTGCACTGATT CACGACTCCTTCGGTACCAT TCCGGCTGACGCTGCGAACC TGTTCAAAGCAGTGCGCGAA ACTATGGTTGACACATATGA GTCTTGTGATGTACTGGCTG ATTTCTACGACCAGTTCGCT GACCAGTTGCACGAGTCTCA ATTGGACAAAATGCCAGCAC TTCCGGCTAAAGGTAACTTG AACCTCCGTGACATCTTAGA GTCGGACTTCGCGTTCGCGT AACGCCAAATCAATACGACT CACTATAGAGGGACAAACTC AAGGTCATTCGCAAGAGTGG CCTTTATGATTGACCTTCTT CCGGTTAATACGACTCACTA TAGGAGAACCTTAAGGTTTA ACTTTAAGACCCTTAAGTGT TAATTAGAGATTTAAATTAA AGAATTACTAAGAGAGGACT TTAAGTATGCGTAACTTCGA AAAGATGACCAAACGTTCTA ACCGTAATGCTCGTGACTTC GAGGCAACCAAAGGTCGCAA GTTGAATAAGACTAAGCGTG ACCGCTCTCACAAGCGTAGC TGGGAGGGTCAGTAAGATGG GACGTTTATATAGTGGTAAT CTGGCAGCATTCAAGGCAGC AACAAACAAGCTGTTCCAGT TAGACTTAGCGGTCATTTAT GATGACTGGTATGATGCCTA TACAAGAAAAGATTGCATAC GGTTACGTATTGAGGACAGG AGTGGAAACCTGATTGATAC TAGCACCTTCTACCACCACG ACGAGGACGTTCTGTTCAAT ATGTGTACTGATTGGTTGAA CCATATGTATGACCAGTTGA AGGACTGGAAGTAATACGAC TCAGTATAGGGACAATGCTT AAGGTCGCTCTCTAGGAGTG GCCTTAGTCATTTAACCAAT AGGAGATAAACATTATGATG AACATTAAGACTAACCCGTT TAAAGCCGTGTCTTTCGTAG AGTCTGCCATTAAGAAGGCT CTGGATAACGCTGGGTATCT TATCGCTGAAATCAAGTACG ATGGTGTACGCGGGAACATC TGCGTAGACAATACTGCTAA CAGTTACTGGCTCTCTCGTG TATCTAAAACGATTCCGGCA CTGGAGCACTTAAACGGGTT TGATGTTCGCTGGAAGCGTC TACTGAACGATGACCGTTGC TTCTACAAAGATGGCTTTAT GCTTGATGGGGAACTCATGG TCAAGGGCGTAGACTTTAAC ACAGGGTCCGGCCTACTGCG TACCAAATGGACTGACACGA AGAACCAAGAGTTCCATGAA GAGTTATTCGTTGAACCAAT CCGTAAGAAAGATAAAGTTC CCTTTAAGCTGCACACTGGA CACCTTCACATAAAACTGTA CGCTATCCTCCCGCTGCACA TCGTGGAGTCTGGAGAAGAC TGTGATGTCATGACGTTGCT CATGCAGGAACACGTTAAGA ACATGCTGCCTCTGCTACAG GAATACTTCCCTGAAATCGA ATGGCAAGCGGCTGAATCTT ACGAGGTCTACGATATGGTA GAACTACAGCAACTGTACGA GCAGAAGCGAGCAGAAGGCC ATGAGGGTCTCATTGTGAAA GACCCGATGTGTATCTATAA GCGCGGTAAGAAATCTGGCT GGTGGAAAATGAAACCTGAG AACGAAGCTGACGGTATCAT TCAGGGTCTGGTATGGGGTA CAAAAGGTCTGGCTAATGAA GGTAAAGTGATTGGTTTTGA GGTGCTTCTTGAGAGTGGTC GTTTAGTTAACGCCACGAAT ATCTCTCGCGCCTTAATGGA TGAGTTCACTGAGACAGTAA AAGAGGCCACCCTAAGTCAA TGGGGATTCTTTAGCCCATA CGGTATTGGCGACAACGATG CTTGTACTATTAACCCTTAC GATGGCTGGGCGTGTCAAAT TAGCTACATGGAGGAAACAC CTGATGGCTCTTTGCGGCAC CCATCGTTCGTAATGTTCCG TGGCACCGAGGACAACCCTC AAGAGAAAATGTAATCACAC TGGCTCACCTTCGGGTGGGC CTTTCTGCGTTTATAAGGAG ACACTTTATGTTTAAGAAGG TTGGTAAATTCCTTGCGGCT TTGGCAGCTATCCTGACGCT TGCGTATATTCTTGCGGTAT ACCCTCAAGTAGCACTAGTA GTAGTTGGCGCTTGTTACTT AGCGGCAGTGTGTGCTTGCG TGTGGAGTATAGTTAACTGG TAATACGACTCACTAAAGGA GGTACACACCATGATGTACT TAATGCCATTACTCATCGTC ATTGTAGGATGCCTTGCGCT CCACTGTAGCGATGATGATA TGCCAGATGGTCACGCTTAA TACGACTCACTAAAGGAGAC ACTATATGTTTCGACTTCAT TACAACAAAAGCGTTAAGAA TTTCACGGTTCGCCGTGCTG ACCGTTCAATCGTATGTGCG AGCGAGCGCCGAGCTAAGAT ACCTCTTATTGGTAACACAG TTCCTTTGGCACCGAGCGTC CACATCATTATCACCCGTGG TGACTTTGAGAAAGCAATAG ACAAGAAACGTCCGGTTCTT AGTGTGGCAGTGACCCGCTT CCCGTTCGTCCGTCTGTTAC TCAAACGAATCAAGGAGGTG TTCTGATGGGACTGTTAGAT GGTGAAGCCTGGGAAAAAGA AAACCCGCCAGTACAAGCAA CTGGGTGTATAGCTTGCTTA GAGAAAGATGACCGTTATCC ACACACCTGTAACAAAGGAG CTAACGATATGACCGAACGT GAACAAGAGATGATCATTAA GTTGATAGACAATAATGAAG GTCGCCCAGATGATTTGAAT GGCTGCGGTATTCTCTGCTC CAATGTCCCTTGCCACCTCT GCCCCGCAAATAACGATCAA AAGATAACCTTAGGTGAAAT CCGAGCGATGGACCCACGTA AACCACATCTGAATAAACCT GAGGTAACTCCTACAGATGA CCAGCCTTCCGCTGAGACAA TCGAAGGTGTCACTAAGCCT TCCCACTACATGCTGTTTGA CGACATTGAGGCTATCGAAG TGATTGCTCGTTCAATGACC GTTGAGCAGTTCAAGGGATA CTGCTTCGGTAACATCTTAA AGTACAGACTACGTGCTGGT AAGAAGTCAGAGTTAGCGTA CTTAGAGAAAGACCTAGCGA AAGCAGACTTCTATAAAGAA CTCTTTGAGAAACATAAGGA TAAATGTTATGCATAACTTC AAGTCAACCCCACCTGCCGA CAGCCTATCTGATGACTTCA CATCTTGCTCAGAGTGGTGC CGAAAGATGTGGGAAGAGAC ATTCGACGATGCGTACATCA AGCTGTATGAACTTTGGAAA TCGAGAGGTCAATGACTATG TCAAACGTAAATACAGGTTC ACTTAGTGTGGACAATAAGA AGTTTTGGGCTACCGTAGAG TCCTCGGAGCATTCCTTCGA GGTTCCAATCTACGCTGAGA CCCTAGACGAAGCTCTGGAG TTAGCCGAATGGCAATACGT TCCGGCTGGCTTTGAGGTTA CTCGTGTGCGTCCTTGTGTA GCACCGAAGTAATACGACTC ACTATTAGGGAAGACTCCCT CTGAGAAACCAAACGAAACC TAAAGGAGATTAACATTATG GCTAAGAAGATTTTCACCTC TGCGCTGGGTACCGCTGAAC CTTACGCTTACATCGCCAAG CCGGACTACGGCAACGAAGA GCGTGGCTTTGGGAACCCTC GTGGTGTCTATAAAGTTGAC CTGACTATTCCCAACAAAGA CCCGCGCTGCCAGCGTATGG TCGATGAAATCGTGAAGTGT CACGAAGAGGCTTATGCTGC TGCCGTTGAGGAATACGAAG CTAATCCACCTGCTGTAGCT CGTGGTAAGAAACCGCTGAA ACCGTATGAGGGTGACATGC CGTTCTTCGATAACGGTGAC GGTACGACTACCTTTAAGTT CAAATGCTACGCGTCTTTCC AAGACAAGAAGACCAAAGAG ACCAAGCACATCAATCTGGT TGTGGTTGACTCAAAAGGTA AGAAGATGGAAGACGTTCCG ATTATCGGTGGTGGCTCTAA GCTGAAAGTTAAATATTCTC TGGTTCCATACAAGTGGAAC ACTGCTGTAGGTGCGAGCGT TAAGCTGCAACTGGAATCCG TGATGCTGGTCGAACTGGCT ACCTTTGGTGGCGGTGAAGA CGATTGGGCTGACGAAGTTG AAGAGAACGGCTATGTTGCC TCTGGTTCTGCCAAAGCGAG CAAACCACGCGACGAAGAAA GCTGGGACGAAGACGACGAA GAGTCCGAGGAAGCAGACGA AGACGGAGACTTCTAAGTGG AACTGCGGGAGAAAATCCTT GAGCGAATCAAGGTGACTTC CTCTGGGTGTTGGGAGTGGC AGGGCGCTACGAACAATAAA GGGTACGGGCAGGTGTGGTG CAGCAATACCGGAAAGGTTG TCTACTGTCATCGCGTAATG TCTAATGCTCCGAAAGGTTC TACCGTCCTGCACTCCTGTG ATAATCCATTATGTTGTAAC CCTGAACACCTATCCATAGG AACTCCAAAAGAGAACTCCA CTGACATGGTAAATAAGGGT CGCTCACACAAGGGGTATAA ACTTTCAGACGAAGACGTAA TGGCAATCATGGAGTCCAGC GAGTCCAATGTATCCTTAGC TCGCACCTATGGTGTCTCCC AACAGACTATTTGTGATATA CGCAAAGGGAGGCGACATGG CAGGTTACGGCGCTAAAGGA ATCCGAAAGGTTGGAGCGTT TCGCTCTGGCCTAGAGGACA AGGTTTCAAAGCAGTTGGAA TCAAAAGGTATTAAATTCGA GTATGAAGAGTGGAAAGTGC CTTATGTAATTCCGGCGAGC AATCACACTTACACTCCAGA CTTCTTACTTCCAAACGGTA TATTCGTTGAGACAAAGGGT CTGTGGGAAAGCGATGATAG AAAGAAGCACTTATTAATTA GGGAGCAGCACCCCGAGCTA GACATCCGTATTGTCTTCTC AAGCTCACGTACTAAGTTAT ACAAAGGTTCTCCAACGTCT TATGGAGAGTTCTGCGAAAA GCATGGTATTAAGTTCGCTG ATAAACTGATACCTGCTGAG TGGATAAAGGAACCCAAGAA GGAGGTCCCCTTTGATAGAT TAAAAAGGAAAGGAGGAAAG AAATAATGGCTCGTGTACAG TTTAAACAACGTGAATCTAC TGACGCAATCTTTGTTCACT GCTCGGCTACCAAGCCAAGT CAGAATGTTGGTGTCCGTGA GATTCGCCAGTGGCACAAAG AGCAGGGTTGGCTCGATGTG GGATACCACTTTATCATCAA GCGAGACGGTACTGTGGAGG CAGGACGAGATGAGATGGCT GTAGGCTCTCACGCTAAGGG TTACAACCACAACTCTATCG GCGTCTGCCTTGTTGGTGGT ATCGACGATAAAGGTAAGTT CGACGCTAACTTTACGCCAG CCCAAATGCAATCCCTTCGC TCACTGCTTGTCACACTGCT GGCTAAGTACGAAGGCGCTG TGCTTCGCGCCCATCATGAG GTGGCGCCGAAGGCTTGCCC TTCGTTCGACCTTAAGCGTT GGTGGGAGAAGAACGAACTG GTCACTTCTGACCGTGGATA ATTAATTGAACTCACTAAAG GGAGACCACAGCGGTTTCCC TTTGTTCGCATTGGAGGTCA AATAATGCGCAAGTCTTATA AACAATTCTATAAGGCTCCG AGGAGGCATATCCAAGTGTG GGAGGCAGCCAATGGGCCTA TACCAAAAGGTTATTATATA GACCACATTGACGGCAATCC ACTCAACGACGCCTTAGACA ATCTCCGTCTGGCTCTCCCA AAAGAAAACTCATGGAACAT GAAGACTCCAAAGAGCAATA CCTCAGGACTAAAGGGACTG AGTTGGAGCAAGGAAAGGGA GATGTGGAGAGGCACTGTAA CAGCTGAGGGTAAACAGCAT AACTTTCGTAGTAGAGATCT ATTGGAAGTCGTTGCGTGGA TTTATAGAACTAGGAGGGAA TTGCATGGACAATTCGCACG ATTCCGATAGTGTATTTCTT TACCACATTCCTTGTGACAA CTGTGGGAGTAGTGATGGGA ACTCGCTGTTCTCTGACGGA CACACGTTCTGCTACGTATG CGAGAAGTGGACTGCTGGTA ATGAAGACACTAAAGAGAGG GCTTCAAAACGGAAACCCTC AGGAGGTAAACCAATGACTT ACAACGTGTGGAACTTCGGG GAATCCAATGGACGCTACTC CGCGTTAACTGCGAGAGGAA TCTCCAAGGAAACCTGTCAG AAGGCTGGCTACTGGATTGC CAAAGTAGACGGTGTGATGT ACCAAGTGGCTGACTATCGG GACCAGAACGGCAACATTGT GAGTCAGAAGGTTCGAGATA AAGATAAGAACTTTAAGACC ACTGGTAGTCACAAGAGTGA CGCTCTGTTCGGGAAGCACT TGTGGAATGGTGGTAAGAAG ATTGTCGTTACAGAAGGTGA AATCGACATGCTTACCGTGA TGGAACTTCAAGACTGTAAG TATCCTGTAGTGTCGTTGGG TCACGGTGCCTCTGCCGCTA AGAAGACATGCGCTGCCAAC TACGAATACTTTGACCAGTT CGAACAGATTATCTTAATGT TCGATATGGACGAAGCAGGG CGCAAAGCAGTCGAAGAGGC TGCACAGGTTCTACCTGCTG GTAAGGTACGAGTGGCAGTT CTTCCGTGTAAGGATGCAAA CGAGTGTCACCTAAATGGTC ACGACCGTGAAATCATGGAG CAAGTGTGGAATGCTGGTCC TTGGATTCCTGATGGTGTGG TATCGGCTCTTTCGTTACGT GAACGAATCCGTGAGCACCT ATCGTCCGAGGAATCAGTAG GTTTACTTTTCAGTGGCTGC ACTGGTATCAACGATAAGAC CTTAGGTGCCCGTGGTGGTG AAGTCATTATGGTCACTTCC GGTTCCGGTATGGGTAAGTC AACGTTCGTCCGTCAACAAG CTCTACAATGGGGCACAGCG ATGGGCAAGAAGGTAGGCTT AGCGATGCTTGAGGAGTCCG TTGAGGAGACCGCTGAGGAC CTTATAGGTCTACACAACCG TGTCCGACTGAGACAATCCG ACTCACTAAAGAGAGAGATT ATTGAGAACGGTAAGTTCGA CCAATGGTTCGATGAACTGT TCGGCAACGATACGTTCCAT CTATATGACTCATTCGCCGA GGCTGAGACGGATAGACTGC TCGCTAAGCTGGCCTACATG CGCTCAGGCTTGGGCTGTGA CGTAATCATTCTAGACCACA TCTCAATCGTCGTATCCGCT TCTGGTGAATCCGATGAGCG TAAGATGATTGACAACCTGA TGACCAAGCTCAAAGGGTTC GCTAAGTCAACTGGGGTGGT GCTGGTCGTAATTTGTCACC TTAAGAACCCAGACAAAGGT AAAGCACATGAGGAAGGTCG CCCCGTTTCTATTACTGACC TACGTGGTTCTGGCGCACTA CGCCAACTATCTGATACTAT TATTGCCCTTGAGCGTAATC AGCAAGGCGATATGCCTAAC CTTGTCCTCGTTCGTATTCT CAAGTGCCGCTTTACTGGTG ATACTGGTATCGCTGGCTAC ATGGAATACAACAAGGAAAC CGGATGGCTTGAACCATCAA GTTACTCAGGGGAAGAAGAG TCACACTCAGAGTCAACAGA CTGGTCCAACGACACTGACT TCTGACAGGATTCTTGATGA CTTTCCAGACGACTACGAGA AGTTTCGCTGGAGAGTCCCA TTCTAATACGACTCACTAAA GGAGACACACCATGTTCAAA CTGATTAAGAAGTTAGGCCA ACTGCTGGTTCGTATGTACA ACGTGGAAGCCAAGCGACTG AACGATGAGGCTCGTAAAGA GGCCACACAGTCACGCGCTC TGGCGATTCGCTCCAACGAA CTGGCTGACAGTGCATCCAC TAAAGTTACCGAGGCTGCCC GTGTGGCAAACCAAGCTCAA CAGCTTTCCAAATTCTTTGA GTAATCAAACAGGAGAAACC ATTATGTCTAACGTAGCTGA AACTATCCGTCTATCCGATA CAGCTGACCAGTGGAACCGT CGAGTCCACATCAACGTTCG CAACGGTAAGGCGACTATGG TTTACCGCTGGAAGGACTCT AAGTCCTCTAAGAATCACAC TCAGCGTATGACGTTGACAG ATGAGCAAGCACTGCGTCTG GTCAATGCGCTTACCAAAGC TGCCGTGACAGCAATTCATG AAGCTGGTCGCGTCAATGAA GCTATGGCTATCCTCGACAA GATTGATAACTAAGAGTGGT ATCCTCAAGGTCGCCAAAGT GGTGGCCTTCATGAATACTA TTCGACTCACTATAGGAGAT ATTACCATGCGTGACCCTAA AGTTATCCAAGCAGAAATCG CTAAACTGGAAGCTGAACTG GAGGACGTTAAGTACCATGA AGCTAAGACTCGCTCCGCTG TTCACATCTTGAAGAACTTA GGCTGGACTTGGACAAGACA GACTGGCTGGAAGAAACCAG AAGTTACCAAGCTGAGTCAT AAGGTGTTCGATAAGGACAC TATGACCCACATCAAGGCTG GTGATTGGGTTAAGGTTGAC ATGGGAGTTGTTGGTGGATA CGGCTACGTCCGCTCAGTTA GTGGCAAATATGCACAAGTG TCATACATCACAGGTGTTAC TCCACGCGGTGCAATCGTTG CCGATAAGACCAACATGATT CACACAGGTTTCTTGACAGT TGTTTCATATGAAGAGATTG TTAAGTCACGATAATCAATA GGAGAAATCAATATGATCGT TTCTGACATCGAAGCTAACG CCCTCTTAGAGAGCGTCACT AAGTTCCACTGCGGGGTTAT CTACGACTACTCCACCGCTG AGTACGTAAGCTACCGTCCG AGTGACTTCGGTGCGTATCT GGATGCGCTGGAAGCCGAGG TTGCACGAGGCGGTCTTATT GTGTTCCACAACGGTCACAA GTATGACGTTCCTGCATTGA CCAAACTGGCAAAGTTGCAA TTGAACCGAGAGTTCCACCT TCCTCGTGAGAACTGTATTG ACACCCTTGTGTTGTCACGT TTGATTCATTCCAACCTCAA GGACACCGATATGGGTCTTC TGCGTTCCGGCAAGTTGCCC GGAAAACGCTTTGGGTCTCA CGCTTTGGAGGCGTGGGGTT ATCGCTTAGGCGAGATGAAG GGTGAATACAAAGACGACTT TAAGCGTATGCTTGAAGAGC AGGGTGAAGAATACGTTGAC GGAATGGAGTGGTGGAACTT CAACGAAGAGATGATGGACT ATAACGTTCAGGACGTTGTG GTAACTAAAGCTCTCCTTGA GAAGCTACTCTCTGACAAAC ATTACTTCCCTCCTGAGATT GACTTTACGGACGTAGGATA CACTACGTTCTGGTCAGAAT CCCTTGAGGCCGTTGACATT GAACATCGTGCTGCATGGCT GCTCGCTAAACAAGAGCGCA ACGGGTTCCCGTTTGACACA AAAGCAATCGAAGAGTTGTA CGTAGAGTTAGCTGCTCGCC GCTCTGAGTTGCTCCGTAAA TTGACCGAAACGTTCGGCTC GTGGTATCAGCCTAAAGGTG GCACTGAGATGTTCTGCCAT CCGCGAACAGGTAAGCCACT ACCTAAATACCCTCGCATTA AGACACCTAAAGTTGGTGGT ATCTTTAAGAAGCCTAAGAA CAAGGCACAGCGAGAAGGCC GTGAGCCTTGCGAACTTGAT ACCCGCGAGTACGTTGCTGG TGCTCCTTACACCCCAGTTG AACATGTTGTGTTTAACCCT TCGTCTCGTGACCACATTCA GAAGAAACTCCAAGAGGCTG GGTGGGTCCCGACCAAGTAC ACCGATAAGGGTGCTCCTGT GGTGGACGATGAGGTACTCG AAGGAGTACGTGTAGATGAC CCTGAGAAGCAAGCCGCTAT CGACCTCATTAAAGAGTACT TGATGATTCAGAAGCGAATC GGACAGTCTGCTGAGGGAGA CAAAGCATGGCTTCGTTATG TTGCTGAGGATGGTAAGATT CATGGTTCTGTTAACCCTAA TGGAGCAGTTACGGGTCGTG CGACCCATGCGTTCCCAAAC CTTGCGCAAATTCCGGGTGT ACGTTCTCCTTATGGAGAGC AGTGTCGCGCTGCTTTTGGC GCTGAGCACCATTTGGATGG GATAACTGGTAAGCCTTGGG TTCAGGCTGGCATCGACGCA TCCGGTCTTGAGCTACGCTG CTTGGCTCACTTCATGGCTC GCTTTGATAACGGCGAGTAC GCTCACGAGATTCTTAACGG CGACATCCACACTAAGAACC AGATAGCTGCTGAACTACCT ACCCGAGATAACGCTAAGAC GTTCATCTATGGGTTCCTCT ATGGTGCTGGTGATGAGAAG ATTGGACAGATTGTTGGTGC TGGTAAAGAGCGCGGTAAGG AACTCAAGAAGAAATTCCTT GAGAACACCCCCGCGATTGC AGCACTCCGCGAGTCTATCC AACAGACACTTGTCGAGTCC TCTCAATGGGTAGCTGGTGA GCAACAAGTCAAGTGGAAAC GCCGCTGGATTAAAGGTCTG GATGGTCGTAAGGTACACGT TCGTAGTCCTCACGCTGCCT TGAATACCCTACTGCAATCT GCTGGTGCTCTCATCTGCAA ACTGTGGATTATCAAGACCG AAGAGATGCTCGTAGAGAAA GGCTTGAAGCATGGCTGGGA TGGGGACTTTGCGTACATGG CATGGGTACATGATGAAATC CAAGTAGGCTGCCGTACCGA AGAGATTGCTCAGGTGGTCA TTGAGACCGCACAAGAAGCG ATGCGCTGGGTTGGAGACCA CTGGAACTTCCGGTGTCTTC TGGATACCGAAGGTAAGATG GGTCCTAATTGGGCGATTTG CCACTGATACAGGAGGCTAC TCATGAACGAAAGACACTTA ACAGGTGCTGCTTCTGAAAT GCTAGTAGCCTACAAATTTA CCAAAGCTGGGTACACTGTC TATTACCCTATGCTGACTCA GAGTAAAGAGGACTTGGTTG TATGTAAGGATGGTAAATTT AGTAAGGTTCAGGTTAAAAC AGCCACAACGGTTCAAACCA ACACAGGAGATGCCAAGCAG GTTAGGCTAGGTGGATGCGG TAGGTCCGAATATAAGGATG GAGACTTTGACATTCTTGCG GTTGTGGTTGACGAAGATGT GCTTATTTTCACATGGGACG AAGTAAAAGGTAAGACATCC ATGTGTGTCGGCAAGAGAAA CAAAGGCATAAAACTATAGG AGAAATTATTATGGCTATGA CAAAGAAATTTAAAGTGTCC TTCGACGTTACCGCAAAGAT GTCGTCTGACGTTCAGGCAA TCTTAGAGAAAGATATGCTG CATCTATGTAAGCAGGTCGG CTCAGGTGCGATTGTCCCCA ATGGTAAACAGAAGGAAATG ATTGTCCAGTTCCTGACACA CGGTATGGAAGGATTGATGA CATTCGTAGTACGTACATCA TTTCGTGAGGCCATTAAGGA CATGCACGAAGAGTATGCAG ATAAGGACTCTTTCAAACAA TCTCCTGCAACAGTACGGGA GGTGTTCTGATGTCTGACTA CCTGAAAGTGCTGCAAGCAA TCAAAAGTTGCCCTAAGACT TTCCAGTCCAACTATGTACG GAACAATGCGAGCCTCGTAG CGGAGGCCGCTTCCCGTGGT CACATCTCGTGCCTGACTAC TAGTGGACGTAACGGTGGCG CTTGGGAAATCACTGCTTCC GGTACTCGCTTTCTGAAACG AATGGGAGGATGTGTCTAAT GTCTCGTGACCTTGTGACTA TTCCACGCGATGTGTGGAAC GATATACAGGGCTACATCGA CTCTCTGGAACGTGAGAACG ATAGCCTTAAGAATCAACTA ATGGAAGCTGACGAATACGT AGCGGAACTAGAGGAGAAAC TTAATGGCACTTCTTGACCT TAAACAATTCTATGAGTTAC GTGAAGGCTGCGACGACAAG GGTATCCTTGTGATGGACGG CGACTGGCTGGTCTTCCAAG CTATGAGTGCTGCTGAGTTT GATGCCTCTTGGGAGGAAGA GATTTGGCACCGATGCTGTG ACCACGCTAAGGCCCGTCAG ATTCTTGAGGATTCCATTAA GTCCTACGAGACCCGTAAGA AGGCTTGGGCAGGTGCTCCA ATTGTCCTTGCGTTCACCGA TAGTGTTAACTGGCGTAAAG AACTGGTTGACCCGAACTAT AAGGCTAACCGTAAGGCCGT GAAGAAACCTGTAGGGTACT TTGAGTTCCTTGATGCTCTC TTTGAGCGCGAAGAGTTCTA TTGCATCCGTGAGCCTATGC TTGAGGGTGATGACGTTATG GGAGTTATTGCTTCCAATCC GTCTGCCTTCGGTGCTCGTA AGGCTGTAATCATCTCTTGC GATAAGGACTTTAAGACCAT CCCTAACTGTGACTTCCTGT GGTGTACCACTGGTAACATC CTGACTCAGACCGAAGAGTC CGCTGACTGGTGGCACCTCT TCCAGACCATCAAGGGTGAC ATCACTGATGGTTACTCAGG GATTGCTGGATGGGGTGATA CCGCCGAGGACTTCTTGAAT AACCCGTTCATAACCGAGCC TAAAACGTCTGTGCTTAAGT CCGGTAAGAACAAAGGCCAA GAGGTTACTAAATGGGTTAA ACGCGACCCTGAGCCTCATG AGACGCTTTGGGACTGCATT AAGTCCATTGGCGCGAAGGC TGGTATGACCGAAGAGGATA TTATCAAGCAGGGCCAAATG GCTCGAATCCTACGGTTCAA CGAGTACAACTTTATTGACA AGGAGATTTACCTGTGGAGA CCGTAGCGTATATTGGTCTG GGTCTTTGTGTTCTCGGAGT GTGCCTCATTTCGTGGGGCC TTTGGGACTTAGCCAGAATA ATCAAGTCGTTACACGACAC TAAGTGATAAACTCAAGGTC CCTAAATTAATACGACTCAC TATAGGGAGATAGGGGCCTT TACGATTATTACTTTAAGAT TTAACTCTAAGAGGAATCTT TATTATGTTAACACCTATTA ACCAATTACTTAAGAACCCT AACGATATTCCAGATGTACC TCGTGCAACCGCTGAGTATC TACAGGTTCGATTCAACTAT GCGTACCTCGAAGCGTCTGG TCATATAGGACTTATGCGTG CTAATGGTTGTAGTGAGGCC CACATCTTGGGTTTCATTCA GGGCCTACAGTATGCCTCTA ACGTCATTGACGAGATTGAG TTACGCAAGGAACAACTAAG AGATGATGGGGAGGATTGAC ACTATGTGTTTCTCACCGAA AATTAAAACTCCGAAGATGG ATACCAATCAGATTCGAGCC GTTGAGCCAGCGCCTCTGAC CCAAGAAGTGTCAAGCGTGG AGTTCGGTGGGTCTTCTGAT GAGACGGATACCGAGGGCAC CGAAGTGTCTGGACGCAAAG GCCTCAAGGTCGAACGTGAT GATTCCGTAGCGAAGTCTAA AGCCAGCGGCAATGGCTCCG CTCGTATGAAATCTTCCATC CGTAAGTCCGCATTTGGAGG TAAGAAGTGATGTCTGAGTT CACATGTGTGGAGGCTAAGA GTCGCTTCCGTGCAATCCGG TGGACTGTGGAACACCTTGG GTTGCCTAAAGGATTCGAAG GACACTTTGTGGGCTACAGC CTCTACGTAGACGAAGTGAT GGACATGTCTGGTTGCCGTG AAGAGTACATTCTGGACTCT ACCGGAAAACATGTAGCGTA CTTCGCGTGGTGCGTAAGCT GTGACATTCACCACAAAGGA GACATTCTGGATGTAACGTC CGTTGTCATTAATCCTGAGG CAGACTCTAAGGGCTTACAG CGATTCCTAGCGAAACGCTT TAAGTACCTTGCGGAACTCC ACGATTGCGATTGGGTGTCT CGTTGTAAGCATGAAGGCGA GACAATGCGTGTATACTTTA AGGAGGTATAAGTTATGGGT AAGAAAGTTAAGAAGGCCGT GAAGAAAGTCACCAAGTCCG TTAAGAAAGTCGTTAAGGAA GGGGCTCGTCCGGTTAAACA GGTTGCTGGCGGTCTAGCTG GTCTGGCTGGTGGTACTGGT GAAGCACAGATGGTGGAAGT ACCACAAGCTGCCGCACAGA TTGTTGACGTACCTGAGAAA GAGGTTTCCACTGAGGACGA AGCACAGACAGAAAGCGGAC GCAAGAAAGCTCGTGCTGGC GGTAAGAAATCCTTGAGTGT AGCCCGTAGCTCCGGTGGCG GTATCAACATTTAATCAGGA GGTTATCGTGGAAGACTGCA TTGAATGGACCGGAGGTGTC AACTCTAAGGGTTATGGTCG TAAGTGGGTTAATGGTAAAC TTGTGACTCCACATAGGCAC ATCTATGAGGAGACATATGG TCCAGTTCCAACAGGAATTG TGGTGATGCATATCTGCGAT AACCCTAGGTGCTATAACAT AAAGCACCTTACGCTTGGAA CTCCAAAGGATAATTCCGAG GACATGGTTACCAAAGGTAG ACAGGCTAAAGGAGAGGAAC TAAGCAAGAAACTTACAGAG TCAGACGTTCTCGCTATACG CTCTTCAACCTTAAGCCACC GCTCCTTAGGAGAACTGTAT GGAGTCAGTCAATCAACCAT AACGCGAATACTACAGCGTA AGACATGGAGACACATTTAA TGGCTGAGAAACGAACAGGA CTTGCGGAGGATGGCGCAAA GTCTGTCTATGAGCGTTTAA AGAACGACCGTGCTCCCTAT GAGACACGCGCTCAGAATTG CGCTCAATATACCATCCCAT CATTGTTCCCTAAGGACTCC GATAACGCCTCTACAGATTA TCAAACTCCGTGGCAAGCCG TGGGCGCTCGTGGTCTGAAC AATCTAGCCTCTAAGCTCAT GCTGGCTCTATTCCCTATGC AGACTTGGATGCGACTTACT ATATCTGAATATGAAGCAAA GCAGTTACTGAGCGACCCCG ATGGACTCGCTAAGGTCGAT GAGGGCCTCTCGATGGTAGA GCGTATCATCATGAACTACA TTGAGTCTAACAGTTACCGC GTGACTCTCTTTGAGGCTCT CAAACAGTTAGTCGTAGCTG GTAACGTCCTGCTGTACCTA CCGGAACCGGAAGGGTCAAA CTATAATCCCATGAAGCTGT ACCGATTGTCTTCTTATGTG GTCCAACGAGACGCATTCGG CAACGTTCTGCAAATGGTGA CTCGTGACCAGATAGCTTTT GGTGCTCTCCCTGAGGACAT CCGTAAGGCTGTAGAAGGTC AAGGTGGTGAGAAGAAAGCT GATGAGACAATCGACGTGTA CACTCACATCTATCTGGATG AGGACTCAGGTGAATACCTC CGATACGAAGAGGTCGAGGG TATGGAAGTCCAAGGCTCCG ATGGGACTTATCCTAAAGAG GCTTGCCCATACATCCCGAT TCGGATGGTCAGACTAGATG GTGAATCCTACGGTCGTTCG TACATTGAGGAATACTTAGG TGACTTACGGTCCCTTGAAA ATCTCCAAGAGGCTATCGTC AAGATGTCCATGATTAGCTC TAAGGTTATCGGCTTAGTGA ATCCTGCTGGTATCACCCAG CCACGCCGACTGACCAAAGC TCAGACTGGTGACTTCGTTA CTGGTCGTCCAGAAGACATC TCGTTCCTCCAACTGGAGAA GCAAGCAGACTTTACTGTAG CTAAAGCCGTAAGTGACGCT ATCGAGGCTCGCCTTTCGTT TGCCTTTATGTTGAACTCTG CGGTTCAGCGTACAGGTGAA CGTGTGACCGCCGAAGAGAT TCGGTATGTAGCTTCTGAAC TTGAAGATACTTTAGGTGGT GTCTACTCTATCCTTTCTCA AGAATTACAATTGCCTCTGG TACGAGTGCTCTTGAAGCAA CTACAAGCCACGCAACAGAT TCCTGAGTTACCTAAGGAAG CCGTAGAGCCAACCATTAGT ACAGGTCTGGAAGCAATTGG TCGAGGACAAGACCTTGATA AGCTGGAGCGGTGTGTCACT GCGTGGGCTGCACTGGCACC TATGCGGGACGACCCTGATA TTAACCTTGCGATGATTAAG TTACGTATTGCCAACGCTAT CGGTATTGACACTTCTGGTA TTCTACTCACCGAAGAACAG AAGCAACAGAAGATGGCCCA ACAGTCTATGCAAATGGGTA TGGATAATGGTGCTGCTGCG CTGGCTCAAGGTATGGCTGC ACAAGCTACAGCTTCACCTG AGGCTATGGCTGCTGCCGCT GATTCCGTAGGTTTACAGCC GGGAATTTAATACGACTCAC TATAGGGAGACCTCATCTTT GAAATGAGCGATGACAAGAG GTTGGAGTCCTCGGTCTTCC TGTAGTTCAACTTTAAGGAG ACAATAATAATGGCTGAATC TAATGCAGACGTATATGCAT CTTTTGGCGTGAACTCCGCT GTGATGTCTGGTGGTTCCGT TGAGGAACATGAGCAGAACA TGCTGGCTCTTGATGTTGCT GCCCGTGATGGCGATGATGC AATCGAGTTAGCGTCAGACG AAGTGGAAACAGAACGTGAC CTGTATGACAACTCTGACCC GTTCGGTCAAGAGGATGACG AAGGCCGCATTCAGGTTCGT ATCGGTGATGGCTCTGAGCC GACCGATGTGGACACTGGAG AAGAAGGCGTTGAGGGCACC GAAGGTTCCGAAGAGTTTAC CCCACTGGGCGAGACTCCAG AAGAACTGGTAGCTGCCTCT GAGCAACTTGGTGAGCACGA AGAGGGCTTCCAAGAGATGA TTAACATTGCTGCTGAGCGT GGCATGAGTGTCGAGACCAT TGAGGCTATCCAGCGTGAGT ACGAGGAGAACGAAGAGTTG TCCGCCGAGTCCTACGCTAA GCTGGCTGAAATTGGCTACA CGAAGGCTTTCATTGACTCG TATATCCGTGGTCAAGAAGC TCTGGTGGAGCAGTACGTAA ACAGTGTCATTGAGTACGCT GGTGGTCGTGAACGTTTTGA TGCACTGTATAACCACCTTG AGACGCACAACCCTGAGGCT GCACAGTCGCTGGATAATGC GTTGACCAATCGTGACTTAG CGACCGTTAAGGCTATCATC AACTTGGCTGGTGAGTCTCG CGCTAAGGCGTTCGGTCGTA AGCCAACTCGTAGTGTGACT AATCGTGCTATTCCGGCTAA ACCTCAGGCTACCAAGCGTG AAGGCTTTGCGGACCGTAGC GAGATGATTAAAGCTATGAG TGACCCTCGGTATCGCACAG ATGCCAACTATCGTCGTCAA GTCGAACAGAAAGTAATCGA TTCGAACTTCTGATAGACTT CGAAATTAATACGACTCACT ATAGGGAGACCACAACGGTT TCCCTCTAGAAATAATTTTG TTTAACTTTAAGAAGGAGAT ATACATATGGCTAGCATGAC TGGTGGACAGCAAATGGGTA CTAACCAAGGTAAAGGTGTA GTTGCTGCTGGAGATAAACT GGCGTTGTTCTTGAAGGTAT TTGGCGGTGAAGTCCTGACT GCGTTCGCTCGTACCTCCGT GACCACTTCTCGCCACATGG TACGTTCCATCTCCAGCGGT AAATCCGCTCAGTTCCCTGT TCTGGGTCGCACTCAGGCAG CGTATCTGGCTCCGGGCGAG AACCTCGACGATAAACGTAA GGACATCAAACACACCGAGA AGGTAATCACCATTGACGGT CTCCTGACGGCTGACGTTCT GATTTATGATATTGAGGACG CGATGAACCACTACGACGTT CGCTCTGAGTATACCTCTCA GTTGGGTGAATCTCTGGCGA TGGCTGCGGATGGTGCGGTT CTGGCTGAGATTGCCGGTCT GTGTAACGTGGAAAGCAAAT ATAATGAGAACATCGAGGGC TTAGGTACTGCTACCGTAAT TGAGACCACTCAGAACAAGG CCGCACTTACCGACCAAGTT GCGCTGGGTAAGGAGATTAT TGCGGCTCTGACTAAGGCTC GTGCGGCTCTGACCAAGAAC TATGTTCCGGCTGCTGACCG TGTGTTCTACTGTGACCCAG ATAGCTACTCTGCGATTCTG GCAGCACTGATGCCGAACGC AGCAAACTACGCTGCTCTGA TTGACCCTGAGAAGGGTTCT ATCCGCAACGTTATGGGCTT TGAGGTTGTAGAAGTTCCGC ACCTCACCGCTGGTGGTGCT GGTACCGCTCGTGAGGGCAC TACTGGTCAGAAGCACGTCT TCCCTGCCAATAAAGGTGAG GGTAATGTCAAGGTTGCTAA GGACAACGTTATCGGCCTGT TCATGCACCGCTCTGCGGTA GGTACTGTTAAGCTGCGTGA CTTGGCTCTGGAGCGCGCTC GCCGTGCTAACTTCCAAGCG GACCAGATTATCGCTAAGTA CGCAATGGGCCACGGTGGTC TTCGCCCAGAAGCTGCTGGT GCAGTGGTTTTCAAAGTGGA GTAATGCTGGGGGTGGCCTC AACGGTCGCTGCTAGTCCCG AAGAGGCGAGTGTTACTTCA ACAGAAGAAACCTTAACGCC AGCACAGGAGGCCGCACGCA CCCGCGCTGCTAACAAAGCC CGAAAGGAAGCTGAGTTGGC TGCTGCCACCGCTGAGCAAT AACTAGCATAACCCCTTGGG GCCTCTAAACGGGTCTTGAG GGGTTTTTTGCTGAAAGGAG GAACTATATGCGCTCATACG ATATGAACGTTGAGACTGCC GCTGAGTTATCAGCTGTGAA CGACATTCTGGCGTCTATCG GTGAACCTCCGGTATCAACG CTGGAAGGTGACGCTAACGC AGATGCAGCGAACGCTCGGC GTATTCTCAACAAGATTAAC CGACAGATTCAATCTCGTGG ATGGACGTTCAACATTGAGG AAGGCATAACGCTACTACCT GATGTTTACTCCAACCTGAT TGTATACAGTGACGACTATT TATCCCTAATGTCTACTTCC GGTCAATCCATCTACGTTAA CCGAGGTGGCTATGTGTATG ACCGAACGAGTCAATCAGAC CGCTTTGACTCTGGTATTAC TGTGAACATTATTCGTCTCC GCGACTACGATGAGATGCCT GAGTGCTTCCGTTACTGGAT TGTCACCAAGGCTTCCCGTC AGTTCAACAACCGATTCTTT GGGGCACCGGAAGTAGAGGG TGTACTCCAAGAAGAGGAAG ATGAGGCTAGACGTCTCTGC ATGGAGTATGAGATGGACTA CGGTGGGTACAATATGCTGG ATGGAGATGCGTTCACTTCT GGTCTACTGACTCGCTAACA TTAATAAATAAGGAGGCTCT AATGGCACTCATTAGCCAAT CAATCAAGAACTTGAAGGGT GGTATCAGCCAACAGCCTGA CATCCTTCGTTATCCAGACC AAGGGTCACGCCAAGTTAAC GGTTGGTCTTCGGAGACCGA GGGCCTCCAAAAGCGTCCAC CTCTTGTTTTCTTAAATACA CTTGGAGACAACGGTGCGTT AGGTCAAGCTCCGTACATCC ACCTGATTAACCGAGATGAG CACGAACAGTATTACGCTGT GTTCACTGGTAGCGGAATCC GAGTGTTCGACCTTTCTGGT AACGAGAAGCAAGTTAGGTA TCCTAACGGTTCCAACTACA TCAAGACCGCTAATCCACGT AACGACCTGCGAATGGTTAC TGTAGCAGACTATACGTTCA TCGTTAACCGTAACGTTGTT GCACAGAAGAACACAAAGTC TGTCAACTTACCGAATTACA ACCCTAATCAAGACGGATTG ATTAACGTTCGTGGTGGTCA GTATGGTAGGGAACTAATTG TACACATTAACGGTAAAGAC GTTGCGAAGTATAAGATACC AGATGGTAGTCAACCTGAAC ACGTAAACAATACGGATGCC CAATGGTTAGCTGAAGAGTT AGCCAAGCAGATGCGCACTA ACTTGTCTGATTGGACTGTA AATGTAGGGCAAGGGTTCAT CCATGTGACCGCACCTAGTG GTCAACAGATTGACTCCTTC ACGACTAAAGATGGCTACGC AGACCAGTTGATTAACCCTG TGACCCACTACGCTCAGTCG TTCTCTAAGCTGCCACCTAA TGCTCCTAACGGCTACATGG TGAAAATCGTAGGGGACGCC TCTAAGTCTGCCGACCAGTA TTACGTTCGGTATGACGCTG AGCGGAAAGTTTGGACTGAG ACTTTAGGTTGGAACACTGA GGACCAAGTTCTATGGGAAA CCATGCCACACGCTCTTGTG CGAGCCGCTGACGGTAATTT CGACTTCAAGTGGCTTGAGT GGTCTCCTAAGTCTTGTGGT GACGTTGACACCAACCCTTG GCCTTCTTTTGTTGGTTCAA GTATTAACGATGTGTTCTTC TTCCGTAACCGCTTAGGATT CCTTAGTGGGGAGAACATCA TATTGAGTCGTACAGCCAAA TACTTCAACTTCTACCCTGC GTCCATTGCGAACCTTAGTG ATGACGACCCTATAGACGTA GCTGTGAGTACCAACCGAAT AGCAATCCTTAAGTACGCCG TTCCGTTCTCAGAAGAGTTA CTCATCTGGTCCGATGAAGC ACAATTCGTCCTGACTGCCT CGGGTACTCTCACATCTAAG TCGGTTGAGTTGAACCTAAC GACCCAGTTTGACGTACAGG ACCGAGCGAGACCTTTTGGG ATTGGGCGTAATGTCTACTT TGCTAGTCCGAGGTCCAGCT TCACGTCCATCCACAGGTAC TACGCTGTGCAGGATGTCAG TTCCGTTAAGAATGCTGAGG ACATTACATCACACGTTCCT AACTACATCCCTAATGGTGT GTTCAGTATTTGCGGAAGTG GTACGGAAAACTTCTGTTCG GTACTATCTCACGGGGACCC TAGTAAAATCTTCATGTACA AATTCCTGTACCTGAACGAA GAGTTAAGGCAACAGTCGTG GTCTCATTGGGACTTTGGGG AAAACGTACAGGTTCTAGCT TGTCAGAGTATCAGCTCAGA TATGTATGTGATTCTTCGCA ATGAGTTCAATACGTTCCTA GCTAGAATCTCTTTCACTAA GAACGCCATTGACTTACAGG GAGAACCCTATCGTGCCTTT ATGGACATGAAGATTCGATA CACGATTCCTAGTGGAACAT ACAACGATGACACATTCACT ACCTCTATTCATATTCCAAC AATTTATGGTGCAAACTTCG GGAGGGGCAAAATCACTGTA TTGGAGCCTGATGGTAAGAT AACCGTGTTTGAGCAACCTA CGGCTGGGTGGAATAGCGAC CCTTGGCTGAGACTCAGCGG TAACTTGGAGGGACGCATGG TGTACATTGGGTTCAACATT AACTTCGTATATGAGTTCTC TAAGTTCCTCATCAAGCAGA CTGCCGACGACGGGTCTACC TCCACGGAAGACATTGGGCG CTTACAGTTACGCCGAGCGT GGGTTAACTACGAGAACTCT GGTACGTTTGACATTTATGT TGAGAACCAATCGTCTAACT GGAAGTACACAATGGCTGGT GCCCGATTAGGCTCTAACAC TCTGAGGGCTGGGAGACTGA ACTTAGGGACCGGACAATAT CGATTCCCTGTGGTTGGTAA CGCCAAGTTCAACACTGTAT ACATCTTGTCAGATGAGACT ACCCCTCTGAACATCATTGG GTGTGGCTGGGAAGGTAACT ACTTACGGAGAAGTTCCGGT ATTTAATTAAATATTCTCCC TGTGGTGGCTCGAAATTAAT ACGACTCACTATAGGGAGAA CAATACGACTACGGGAGGGT TTTCTTATGATGACTATAAG ACCTACTAAAAGTACAGACT TTGAGGTATTCACTCCGGCT CACCATGACATTCTTGAAGC TAAGGCTGCTGGTATTGAGC CGAGTTTCCCTGATGCTTCC GAGTGTGTCACGTTGAGCCT CTATGGGTTCCCTCTAGCTA TCGGTGGTAACTGCGGGGAC CAGTGCTGGTTCGTTACGAG CGACCAAGTGTGGCGACTTA GTGGAAAGGCTAAGCGAAAG TTCCGTAAGTTAATCATGGA GTATCGCGATAAGATGCTTG AGAAGTATGATACTCTTTGG AATTACGTATGGGTAGGCAA TACGTCCCACATTCGTTTCC TCAAGACTATCGGTGCGGTA TTCCATGAAGAGTACACACG AGATGGTCAATTTCAGTTAT TTACAATCACGAAAGGAGGA TAACCATATGTGTTGGGCAG CCGCAATACCTATCGCTATA TCTGGCGCTCAGGCTATCAG TGGTCAGAACGCTCAGGCCA AAATGATTGCCGCTCAGACC GCTGCTGGTCGTCGTCAAGC TATGGAAATCATGAGGCAGA CGAACATCCAGAATGCTGAC CTATCGTTGCAAGCTCGAAG TAAACTTGAGGAAGCGTCCG CCGAGTTGACCTCACAGAAC ATGCAGAAGGTCCAAGCTAT TGGGTCTATCCGAGCGGCTA TCGGAGAGAGTATGCTTGAA GGTTCCTCAATGGACCGCAT TAAGCGAGTCACAGAAGGAC AGTTCATTCGGGAAGCCAAT ATGGTAACTGAGAACTATCG CCGTGACTACCAAGCAATCT TCGCACAGCAACTTGGTGGT ACTCAAAGTGCTGCAAGTCA GATTGACGAAATCTATAAGA GCGAACAGAAACAGAAGAGT AAGCTACAGATGGTTCTGGA CCCACTGGCTATCATGGGGT CTTCCGCTGCGAGTGCTTAC GCATCCGGTGCGTTCGACTC TAAGTCCACAACTAAGGCAC CTATTGTTGCCGCTAAAGGA ACCAAGACGGGGAGGTAATG AGCTATGAGTAAAATTGAAT CTGCCCTTCAAGCGGCACAA CCGGGACTCTCTCGGTTACG TGGTGGTGCTGGAGGTATGG GCTATCGTGCAGCAACCACT CAGGCCGAACAGCCAAGGTC AAGCCTATTGGACACCATTG GTCGGTTCGCTAAGGCTGGT GCCGATATGTATACCGCTAA GGAACAACGAGCACGAGACC TAGCTGATGAACGCTCTAAC GAGATTATCCGTAAGCTGAC CCCTGAGCAACGTCGAGAAG CTCTCAACAACGGGACCCTT CTGTATCAGGATGACCCATA CGCTATGGAAGCACTCCGAG TCAAGACTGGTCGTAACGCT GCGTATCTTGTGGACGATGA CGTTATGCAGAAGATAAAAG AGGGTGTCTTCCGTACTCGC GAAGAGATGGAAGAGTATCG CCATAGTCGCCTTCAAGAGG GCGCTAAGGTATACGCTGAG CAGTTCGGCATCGACCCTGA GGACGTTGATTATCAGCGTG GTTTCAACGGGGACATTACC GAGCGTAACATCTCGCTGTA TGGTGCGCATGATAACTTCT TGAGCCAGCAAGCTCAGAAG GGCGCTATCATGAACAGCCG AGTGGAACTCAACGGTGTCC TTCAAGACCCTGATATGCTG CGTCGTCCAGACTCTGCTGA CTTCTTTGAGAAGTATATCG ACAACGGTCTGGTTACTGGC GCAATCCCATCTGATGCTCA AGCCACACAGCTTATAAGCC AAGCGTTCAGTGACGCTTCT AGCCGTGCTGGTGGTGCTGA CTTCCTGATGCGAGTCGGTG ACAAGAAGGTAACACTTAAC GGAGCCACTACGACTTACCG AGAGTTGATTGGTGAGGAAC AGTGGAACGCTCTCATGGTC ACAGCACAACGTTCTCAGTT TGAGACTGACGCGAAGCTGA ACGAGCAGTATCGCTTGAAG ATTAACTCTGCGCTGAACCA AGAGGACCCAAGGACAGCTT GGGAGATGCTTCAAGGTATC AAGGCTGAACTAGATAAGGT CCAACCTGATGAGCAGATGA CACCACAACGTGAGTGGCTA ATCTCCGCACAGGAACAAGT TCAGAATCAGATGAACGCAT GGACGAAAGCTCAGGCCAAG GCTCTGGACGATTCCATGAA GTCAATGAACAAACTTGACG TAATCGACAAGCAATTCCAG AAGCGAATCAACGGTGAGTG GGTCTCAACGGATTTTAAGG ATATGCCAGTCAACGAGAAC ACTGGTGAGTTCAAGCATAG CGATATGGTTAACTACGCCA ATAAGAAGCTCGCTGAGATT GACAGTATGGACATTCCAGA CGGTGCCAAGGATGCTATGA AGTTGAAGTACCTTCAAGCG GACTCTAAGGACGGAGCATT CCGTACAGCCATCGGAACCA TGGTCACTGACGCTGGTCAA GAGTGGTCTGCCGCTGTGAT TAACGGTAAGTTACCAGAAC GAACCCCAGCTATGGATGCT CTGCGCAGAATCCGCAATGC TGACCCTCAGTTGATTGCTG CGCTATACCCAGACCAAGCT GAGCTATTCCTGACGATGGA CATGATGGACAAGCAGGGTA TTGACCCTCAGGTTATTCTT GATGCCGACCGACTGACTGT TAAGCGGTCCAAAGAGCAAC GCTTTGAGGATGATAAAGCA TTCGAGTCTGCACTGAATGC ATCTAAGGCTCCTGAGATTG CCCGTATGCCAGCGTCACTG CGCGAATCTGCACGTAAGAT TTATGACTCCGTTAAGTATC GCTCGGGGAACGAAAGCATG GCTATGGAGCAGATGACCAA GTTCCTTAAGGAATCTACCT ACACGTTCACTGGTGATGAT GTTGACGGTGATACCGTTGG TGTGATTCCTAAGAATATGA TGCAGGTTAACTCTGACCCG AAATCATGGGAGCAAGGTCG GGATATTCTGGAGGAAGCAC GTAAGGGAATCATTGCGAGC AACCCTTGGATAACCAATAA GCAACTGACCATGTATTCTC AAGGTGACTCCATTTACCTT ATGGACACCACAGGTCAAGT CAGAGTCCGATACGACAAAG AGTTACTCTCGAAGGTCTGG AGTGAGAACCAGAAGAAACT CGAAGAGAAAGCTCGTGAGA AGGCTCTGGCTGATGTGAAC AAGCGAGCACCTATAGTTGC CGCTACGAAGGCCCGTGAAG CTGCTGCTAAACGAGTCCGA GAGAAACGTAAACAGACTCC TAAGTTCATCTACGGACGTA AGGAGTAACTAAAGGCTACA TAAGGAGGCCCTAAATGGAT AAGTACGATAAGAACGTACC AAGTGATTATGATGGTCTGT TCCAAAAGGCTGCTGATGCC AACGGGGTCTCTTATGACCT TTTACGTAAAGTCGCTTGGA CAGAATCACGATTTGTGCCT ACAGCAAAATCTAAGACTGG ACCATTAGGCATGATGCAAT TTACCAAGGCAACCGCTAAG GCCCTCGGTCTGCGAGTTAC CGATGGTCCAGACGACGACC GACTGAACCCTGAGTTAGCT ATTAATGCTGCCGCTAAGCA ACTTGCAGGTCTGGTAGGGA AGTTTGATGGCGATGAACTC AAAGCTGCCCTTGCGTACAA CCAAGGCGAGGGACGCTTGG GTAATCCACAACTTGAGGCG TACTCTAAGGGAGACTTCGC ATCAATCTCTGAGGAGGGAC GTAACTACATGCGTAACCTT CTGGATGTTGCTAAGTCACC TATGGCTGGACAGTTGGAAA CTTTTGGTGGCATAACCCCA AAGGGTAAAGGCATTCCGGC TGAGGTAGGATTGGCTGGAA TTGGTCACAAGCAGAAAGTA ACACAGGAACTTCCTGAGTC CACAAGTTTTGACGTTAAGG GTATCGAACAGGAGGCTACG GCGAAACCATTCGCCAAGGA CTTTTGGGAGACCCACGGAG AAACACTTGACGAGTACAAC AGTCGTTCAACCTTCTTCGG ATTCAAAAATGCTGCCGAAG CTGAACTCTCCAACTCAGTC GCTGGGATGGCTTTCCGTGC TGGTCGTCTCGATAATGGTT TTGATGTGTTTAAAGACACC ATTACGCCGACTCGCTGGAA CTCTCACATCTGGACTCCAG AGGAGTTAGAGAAGATTCGA ACAGAGGTTAAGAACCCTGC GTACATCAACGTTGTAACTG GTGGTTCCCCTGAGAACCTC GATGACCTCATTAAATTGGC TAACGAGAACTTTGAGAATG ACTCCCGCGCTGCCGAGGCT GGCCTAGGTGCCAAACTGAG TGCTGGTATTATTGGTGCTG GTGTGGACCCGCTTAGCTAT GTTCCTATGGTCGGTGTCAC TGGTAAGGGCTTTAAGTTAA TCAATAAGGCTCTTGTAGTT GGTGCCGAAAGTGCTGCTCT GAACGTTGCATCCGAAGGTC TCCGTACCTCCGTAGCTGGT GGTGACGCAGACTATGCGGG TGCTGCCTTAGGTGGCTTTG TGTTTGGCGCAGGCATGTCT GCAATCAGTGACGCTGTAGC TGCTGGACTGAAACGCAGTA AACCAGAAGCTGAGTTCGAC AATGAGTTCATCGGTCCTAT GATGCGATTGGAAGCCCGTG AGACAGCACGAAACGCCAAC TCTGCGGACCTCTCTCGGAT GAACACTGAGAACATGAAGT TTGAAGGTGAACATAATGGT GTCCCTTATGAGGACTTACC AACAGAGAGAGGTGCCGTGG TGTTACATGATGGCTCCGTT CTAAGTGCAAGCAACCCAAT CAACCCTAAGACTCTAAAAG AGTTCTCCGAGGTTGACCCT GAGAAGGCTGCGCGAGGAAT CAAACTGGCTGGGTTCACCG AGATTGGCTTGAAGACCTTG GGGTCTGACGATGCTGACAT CCGTAGAGTGGCTATCGACC TCGTTCGCTCTCCTACTGGT ATGCAGTCTGGTGCCTCAGG TAAGTTCGGTGCAACAGCTT CTGACATCCATGAGAGACTT CATGGTACTGACCAGCGTAC TTATAATGACTTGTACAAAG CAATGTCTGACGCTATGAAA GACCCTGAGTTCTCTACTGG CGGCGCTAAGATGTCCCGTG AAGAAACTCGATACACTATC TACCGTAGAGCGGCACTAGC TATTGAGCGTCCAGAACTAC AGAAGGCACTCACTCCGTCT GAGAGAATCGTTATGGACAT CATTAAGCGTCACTTTGACA CCAAGCGTGAACTTATGGAA AACCCAGCAATATTCGGTAA CACAAAGGCTGTGAGTATCT TCCCTGAGAGTCGCCACAAA GGTACTTACGTTCCTCACGT ATATGACCGTCATGCCAAGG CGCTGATGATTCAACGCTAC GGTGCCGAAGGTTTGCAGGA AGGGATTGCCCGCTCATGGA TGAACAGCTACGTCTCCAGA CCTGAGGTCAAGGCCAGAGT CGATGAGATGCTTAAGGAAT TACACGGGGTGAAGGAAGTA ACACCAGAGATGGTAGAGAA GTACGCTATGGATAAGGCTT ATGGTATCTCCCACTCAGAC CAGTTCACCAACAGTTCCAT AATAGAAGAGAACATTGAGG GCTTAGTAGGTATCGAGAAT AACTCATTCCTTGAGGCACG TAACTTGTTTGATTCGGACC TATCCATCACTATGCCAGAC GGACAGCAATTCTCAGTGAA TGACCTAAGGGACTTCGATA TGTTCCGCATCATGCCAGCG TATGACCGCCGTGTCAATGG TGACATCGCCATCATGGGGT CTACTGGTAAAACCACTAAG GAACTTAAGGATGAGATTTT GGCTCTCAAAGCGAAAGCTG AGGGAGACGGTAAGAAGACT GGCGAGGTACATGCTTTAAT GGATACCGTTAAGATTCTTA CTGGTCGTGCTAGACGCAAT CAGGACACTGTGTGGGAAAC CTCACTGCGTGCCATCAATG ACCTAGGGTTCTTCGCTAAG AACGCCTACATGGGTGCTCA GAACATTACGGAGATTGCTG GGATGATTGTCACTGGTAAC GTTCGTGCTCTAGGGCATGG TATCCCAATTCTGCGTGATA CACTCTACAAGTCTAAACCA GTTTCAGCTAAGGAACTCAA GGAACTCCATGCGTCTCTGT TCGGGAAGGAGGTGGACCAG TTGATTCGGCCTAAACGTGC TGACATTGTGCAGCGCCTAA GGGAAGCAACTGATACCGGA CCTGCCGTGGCGAACATCGT AGGGACCTTGAAGTATTCAA CACAGGAACTGGCTGCTCGC TCTCCGTGGACTAAGCTACT GAACGGAACCACTAACTACC TTCTGGATGCTGCGCGTCAA GGTATGCTTGGGGATGTTAT TAGTGCCACCCTAACAGGTA AGACTACCCGCTGGGAGAAA GAAGGCTTCCTTCGTGGTGC CTCCGTAACTCCTGAGCAGA TGGCTGGCATCAAGTCTCTC ATCAAGGAACATATGGTACG CGGTGAGGACGGGAAGTTTA CCGTTAAGGACAAGCAAGCG TTCTCTATGGACCCACGGGC TATGGACTTATGGAGACTGG CTGACAAGGTAGCTGATGAG GCAATGCTGCGTCCACATAA GGTGTCCTTACAGGATTCCC ATGCGTTCGGAGCACTAGGT AAGATGGTTATGCAGTTTAA GTCTTTCACTATCAAGTCCC TTAACTCTAAGTTCCTGCGA ACCTTCTATGATGGATACAA GAACAACCGAGCGATTGACG CTGCGCTGAGCATCATCACC TCTATGGGTCTCGCTGGTGG TTTCTATGCTATGGCTGCAC ACGTCAAAGCATACGCTCTG CCTAAGGAGAAACGTAAGGA GTACTTGGAGCGTGCACTGG ACCCAACCATGATTGCCCAC GCTGCGTTATCTCGTAGTTC TCAATTGGGTGCTCCTTTGG CTATGGTTGACCTAGTTGGT GGTGTTTTAGGGTTCGAGTC CTCCAAGATGGCTCGCTCTA CGATTCTACCTAAGGACACC GTGAAGGAACGTGACCCAAA CAAACCGTACACCTCTAGAG AGGTAATGGGCGCTATGGGT TCAAACCTTCTGGAACAGAT GCCTTCGGCTGGCTTTGTGG CTAACGTAGGGGCTACCTTA ATGAATGCTGCTGGCGTGGT CAACTCACCTAATAAAGCAA CCGAGCAGGACTTCATGACT GGTCTTATGAACTCCACAAA AGAGTTAGTACCGAACGACC CATTGACTCAACAGCTTGTG TTGAAGATTTATGAGGCGAA CGGTGTTAACTTGAGGGAGC GTAGGAAATAATACGACTCA CTATAGGGAGAGGCGAAATA ATCTTCTCCCTGTAGTCTCT TAGATTTACTTTAAGGAGGT CAAATGGCTAACGTAATTAA AACCGTTTTGACTTACCAGT TAGATGGCTCCAATCGTGAT TTTAATATCCCGTTTGAGTA TCTAGCCCGTAAGTTCGTAG TGGTAACTCTTATTGGTGTA GACCGAAAGGTCCTTACGAT TAATACAGACTATCGCTTTG CTACACGTACTACTATCTCT CTGACAAAGGCTTGGGGTCC AGCCGATGGCTACACGACCA TCGAGTTACGTCGAGTAACC TCCACTACCGACCGATTGGT TGACTTTACGGATGGTTCAA TCCTCCGCGCGTATGACCTT AACGTCGCTCAGATTCAAAC GATGCACGTAGCGGAAGAGG CCCGTGACCTCACTACGGAT ACTATCGGTGTCAATAACGA TGGTCACTTGGATGCTCGTG GTCGTCGAATTGTGAACCTA GCGAACGCCGTGGATGACCG CGATGCTGTTCCGTTTGGTC AACTAAAGACCATGAACCAG AACTCATGGCAAGCACGTAA TGAAGCCTTACAGTTCCGTA ATGAGGCTGAGACTTTCAGA AACCAAGCGGAGGGCTTTAA GAACGAGTCCAGTACCAACG CTACGAACACAAAGCAGTGG CGCGATGAGACCAAGGGTTT CCGAGACGAAGCCAAGCGGT TCAAGAATACGGCTGGTCAA TACGCTACATCTGCTGGGAA CTCTGCTTCCGCTGCGCATC AATCTGAGGTAAACGCTGAG AACTCTGCCACAGCATCCGC TAACTCTGCTCATTTGGCAG AACAGCAAGCAGACCGTGCG GAACGTGAGGCAGACAAGCT GGAAAATTACAATGGATTGG CTGGTGCAATTGATAAGGTA GATGGAACCAATGTGTACTG GAAAGGAAATATTCACGCTA ACGGGCGCCTTTACATGACC ACAAACGGTTTTGACTGTGG CCAGTATCAACAGTTCTTTG GTGGTGTCACTAATCGTTAC TCTGTCATGGAGTGGGGAGA TGAGAACGGATGGCTGATGT ATGTTCAACGTAGAGAGTGG ACAACAGCGATAGGCGGTAA CATCCAGTTAGTAGTAAACG GACAGATCATCACCCAAGGT GGAGCCATGACCGGTCAGCT AAAATTGCAGAATGGGCATG TTCTTCAATTAGAGTCCGCA TCCGACAAGGCGCACTATAT TCTATCTAAAGATGGTAACA GGAATAACTGGTACATTGGT AGAGGGTCAGATAACAACAA TGACTGTACCTTCCACTCCT ATGTACATGGTACGACCTTA ACACTCAAGCAGGACTATGC AGTAGTTAACAAACACTTCC ACGTAGGTCAGGCCGTTGTG GCCACTGATGGTAATATTCA AGGTACTAAGTGGGGAGGTA AATGGCTGGATGCTTACCTA CGTGACAGCTTCGTTGCGAA GTCCAAGGCGTGGACTCAGG TGTGGTCTGGTAGTGCTGGC GGTGGGGTAAGTGTGACTGT TTCACAGGATCTCCGCTTCC GCAATATCTGGATTAAGTGT GCCAACAACTCTTGGAACTT CTTCCGTACTGGCCCCGATG GAATCTACTTCATAGCCTCT GATGGTGGATGGTTACGATT CCAAATACACTCCAACGGTC TCGGATTCAAGAATATTGCA GACAGTCGTTCAGTACCTAA TGCAATCATGGTGGAGAACG AGTAATTGGTAAATCACAAG GAAAGACGTGTAGTCCACGG ATGGACTCTCAAGGAGGTAC AAGGTGCTATCATTAGACTT TAACAACGAATTGATTAAGG CTGCTCCAATTGTTGGGACG GGTGTAGCAGATGTTAGTGC TCGACTGTTCTTTGGGTTAA GCCTTAACGAATGGTTCTAC GTTGCTGCTATCGCCTACAC AGTGGTTCAGATTGGTGCCA AGGTAGTCGATAAGATGATT GACTGGAAGAAAGCCAATAA GGAGTGATATGTATGGAAAA GGATAAGAGCCTTATTACAT TCTTAGAGATGTTGGACACT GCGATGGCTCAGCGTATGCT TGCGGACCTTTCGGACCATG AGCGTCGCTCTCCGCAACTC TATAATGCTATTAACAAACT GTTAGACCGCCACAAGTTCC AGATTGGTAAGTTGCAGCCG GATGTTCACATCTTAGGTGG CCTTGCTGGTGCTCTTGAAG AGTACAAAGAGAAAGTCGGT GATAACGGTCTTACGGATGA TGATATTTACACATTACAGT GATATACTCAAGGCCACTAC AGATAGTGGTCTTTATGGAT GTCATTGTCTATACGAGATG CTCCTACGTGAAATCTGAAA GTTAACGGGAGGCATTATGC TAGAATTTTTACGTAAGCTA ATCCCTTGGGTTCTCGCTGG GATGCTATTCGGGTTAGGAT GGCATCTAGGGTCAGACTCA ATGGACGCTAAATGGAAACA GGAGGTACACAATGAGTACG TTAAGAGAGTTGAGGCTGCG AAGAGCACTCAAAGAGCAAT CGATGCGGTATCTGCTAAGT ATCAAGAAGACCTTGCCGCG CTGGAAGGGAGCACTGATAG GATTATTTCTGATTTGCGTA GCGACAATAAGCGGTTGCGC GTCAGAGTCAAAACTACCGG AACCTCCGATGGTCAGTGTG GATTCGAGCCTGATGGTCGA GCCGAACTTGACGACCGAGA TGCTAAACGTATTCTCGCAG TGACCCAGAAGGGTGACGCA TGGATTCGTGCGTTACAGGA TACTATTCGTGAACTGCAAC GTAAGTAGGAAATCAAGTAA GGAGGCAATGTGTCTACTCA ATCCAATCGTAATGCGCTCG TAGTGGCGCAACTGAAAGGA GACTTCGTGGCGTTCCTATT CGTCTTATGGAAGGCGCTAA ACCTACCGGTGCCCACTAAG TGTCAGATTGACATGGCTAA GGTGCTGGCGAATGGAGACA ACAAGAAGTTCATCTTACAG GCTTTCCGTGGTATCGGTAA GTCGTTCATCACATGTGCGT TCGTTGTGTGGTCCTTATGG AGAGACCCTCAGTTGAAGAT ACTTATCGTATCAGCCTCTA AGGAGCGTGCAGACGCTAAC TCCATCTTTATTAAGAACAT CATTGACCTGCTGCCATTCC TATCTGAGTTAAAGCCAAGA CCCGGACAGCGTGACTCGGT AATCAGCTTTGATGTAGGCC CAGCCAATCCTGACCACTCT CCTAGTGTGAAATCAGTAGG TATCACTGGTCAGTTAACTG GTAGCCGTGCTGACATTATC ATTGCGGATGACGTTGAGAT TCCGTCTAACAGCGCAACTA TGGGTGCCCGTGAGAAGCTA TGGACTCTGGTTCAGGAGTT CGCTGCGTTACTTAAACCGC TGCCTTCCTCTCGCGTTATC TACCTTGGTACACCTCAGAC AGAGATGACTCTCTATAAGG AACTTGAGGATAACCGTGGG TACACAACCATTATCTGGCC TGCTCTGTACCCAAGGACAC GTGAAGAGAACCTCTATTAC TCACAGCGTCTTGCTCCTAT GTTACGCGCTGAGTACGATG AGAACCCTGAGGCACTTGCT GGGACTCCAACAGACCCAGT GCGCTTTGACCGTGATGACC TGCGCGAGCGTGAGTTGGAA TACGGTAAGGCTGGCTTTAC GCTACAGTTCATGCTTAACC CTAACCTTAGTGATGCCGAG AAGTACCCGCTGAGGCTTCG TGACGCTATCGTAGCGGCCT TAGACTTAGAGAAGGCCCCA ATGCATTACCAGTGGCTTCC GAACCGTCAGAACATCATTG AGGACCTTCCTAACGTTGGC CTTAAGGGTGATGACCTGCA TACGTACCACGATTGTTCCA ACAACTCAGGTCAGTACCAA CAGAAGATTCTGGTCATTGA CCCTAGTGGTCGCGGTAAGG ACGAAACAGGTTACGCTGTG CTGTACACACTGAACGGTTA CATCTACCTTATGGAAGCTG GAGGTTTCCGTGATGGCTAC TCCGATAAGACCCTTGAGTT ACTCGCTAAGAAGGCAAAGC AATGGGGAGTCCAGACGGTT GTCTACGAGAGTAACTTCGG TGACGGTATGTTCGGTAAGG TATTCAGTCCTATCCTTCTT AAACACCACAACTGTGCGAT GGAAGAGATTCGTGCCCGTG GTATGAAAGAGATGCGTATT TGCGATACCCTTGAGCCAGT CATGCAGACTCACCGCCTTG TAATTCGTGATGAGGTCATT AGGGCCGACTACCAGTCCGC TCGTGACGTAGACGGTAAGC ATGACGTTAAGTACTCGTTG TTCTACCAGATGACCCGTAT CACTCGTGAGAAAGGCGCTC TGGCTCATGATGACCGATTG GATGCCCTTGCGTTAGGCAT TGAGTATCTCCGTGAGTCCA TGCAGTTGGATTCCGTTAAG GTCGAGGGTGAAGTACTTGC TGACTTCCTTGAGGAACACA TGATGCGTCCTACGGTTGCT GCTACGCATATCATTGAGAT GTCTGTGGGAGGAGTTGATG TGTACTCTGAGGACGATGAG GGTTACGGTACGTCTTTCAT TGAGTGGTGATTTATGCATT AGGACTGCATAGGGATGCAC TATAGACCACGGATGGTCAG TTCTTTAAGTTACTGAAAAG ACACGATAAATTAATACGAC TCACTATAGGGAGAGGAGGG ACGAAAGGTTACTATATAGA TACTGAATGAATACTTATAG AGTGCATAAAGTATGCATAA TGGTGTACCTAGAGTGACCT CTAAGAATGGTGATTATATT GTATTAGTATCACCTTAACT TAAGGACCAACATAAAGGGA GGAGACTCATGTTCCGCTTA TTGTTGAACCTACTGCGGCA TAGAGTCACCTACCGATTTC TTGTGGTACTTTGTGCTGCC CTTGGGTACGCATCTCTTAC TGGAGACCTCAGTTCACTGG AGTCTGTCGTTTGCTCTATA CTCACTTGTAGCGATTAGGG TCTTCCTGACCGACTGATGG CTCACCGAGGGATTCAGCGG TATGATTGCATCACACCACT TCATCCCTATAGAGTCAAGT CCTAAGGTATACCCATAAAG AGCCTCTAATGGTCTATCCT AAGGTCTATACCTAAAGATA GGCCATCCTATCAGTGTCAC CTAAAGAGGGTCTTAGAGAG GGCCTATGGAGTTCCTATAG GGTCCTTTAAAATATACCAT AAAAATCTGAGTGACTATCT CACAGTGTACGGACCTAAAG TTCCCCCATAGGGGGTACCT AAAGCCCAGCCAATCACCTA AAGTCAACCTTCGGTTGACC TTGAGGGTTCCCTAAGGGTT GGGGATGACCCTTGGGTTTG TCTTTGGGTGTTACCTTGAG TGTCTCTCTGTGTCCCT

Data sets:
Data typeCount
13C chemical shifts39
15N chemical shifts14

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1dsDNA1

Entities:

Entity 1, dsDNA 39937 residues - Formula weight is not available

1   DTDCDTDCDADCDADGDTDG
2   DTDADCDGDGDADCDCDTDA
3   DADADGDTDTDCDCDCDCDC
4   DADTDADGDGDGDGDGDTDA
5   DCDCDTDADADADGDCDCDC
6   DADGDCDCDADADTDCDADC
7   DCDTDADADADGDTDCDADA
8   DCDCDTDTDCDGDGDTDTDG
9   DADCDCDTDTDGDADGDGDG
10   DTDTDCDCDCDTDADADGDG
11   DGDTDTDGDGDGDGDADTDG
12   DADCDCDCDTDTDGDGDGDT
13   DTDTDGDTDCDTDTDTDGDG
14   DGDTDGDTDTDADCDCDTDT
15   DGDADGDTDGDTDCDTDCDT
16   DCDTDGDTDGDTDCDCDCDT
17   DADTDCDTDGDTDTDADCDA
18   DGDTDCDTDCDCDTDADADA
19   DGDTDADTDCDCDTDCDCDT
20   DADADADGDTDCDADCDCDT
21   DCDCDTDADADCDGDTDCDC
22   DADTDCDCDTDADADADGDC
23   DCDADADCDADCDCDTDADA
24   DADGDCDCDTDADCDADCDC
25   DTDADADADGDADCDCDCDA
26   DTDCDADADGDTDCDADADC
27   DGDCDCDTDADTDCDTDTDA
28   DADADGDTDTDTDADADADC
29   DADTDADADADGDADCDCDA
30   DGDADCDCDTDADADADGDA
31   DCDCDADGDADCDCDTDADA
32   DADGDADCDADCDTDADCDA
33   DTDADADADGDADCDCDADG
34   DADCDCDTDADADADGDADC
35   DGDCDCDTDTDGDTDTDGDT
36   DTDADGDCDCDADTDADADA
37   DGDTDGDADTDADADCDCDT
38   DTDTDADADTDCDADTDTDG
39   DTDCDTDTDTDADTDTDADA
40   DTDADCDADADCDTDCDADC
41   DTDADTDADADGDGDADGDA
42   DGDADCDADADCDTDTDADA
43   DADGDADGDADCDTDTDADA
44   DADADGDADTDTDADADTDT
45   DTDADADADADTDTDTDADT
46   DCDADADADADADGDADGDT
47   DADTDTDGDADCDTDTDADA
48   DADGDTDCDTDADADCDCDT
49   DADTDADGDGDADTDADCDT
50   DTDADCDADGDCDCDADTDC
51   DGDADGDADGDGDGDADCDA
52   DCDGDGDCDGDADADTDADG
53   DCDCDADTDCDCDCDADADT
54   DCDGDADCDADCDCDGDGDG
55   DGDTDCDADADCDCDGDGDA
56   DTDADADGDTDADGDADCDA
57   DGDCDCDTDGDADTDADADG
58   DTDCDGDCDADCDGDADADA
59   DADADCDADGDGDTDADTDT
60   DGDADCDADADCDADTDGDA
61   DADGDTDADADCDADTDGDC
62   DADGDTDADADGDADTDADC
63   DADADADTDCDGDCDTDADG
64   DGDTDADADCDADCDTDADG
65   DCDADGDCDGDTDCDADADC
66   DCDGDGDGDCDGDCDADCDA
67   DGDTDGDCDCDTDTDCDTDA
68   DGDGDTDGDADCDTDTDADA
69   DGDCDGDCDADCDCDADCDG
70   DGDCDADCDADTDADADGDG
71   DTDGDADADADCDADADADA
72   DCDGDGDTDTDGDADCDADA
73   DCDADTDGDADADGDTDADA
74   DADCDADCDGDGDTDADCDG
75   DADTDGDTDADCDCDADCDA
76   DTDGDADADADCDGDADCDA
77   DGDTDGDADGDTDCDADCDC
78   DADCDADCDTDGDADADADG
79   DGDTDGDADTDGDCDGDGDT
80   DCDTDADADCDGDADADADC
81   DCDTDGDADCDCDTDADADG
82   DADCDGDCDTDCDTDTDTDA
83   DADCDADADTDCDTDGDGDT
84   DADADADTDADGDCDTDCDT
85   DTDGDADGDTDGDCDADTDG
86   DADCDTDADGDCDGDGDADT
87   DADADCDTDCDADADGDGDG
88   DTDADTDCDGDCDADADGDG
89   DTDGDCDCDCDTDTDTDADT
90   DGDADTDADTDTDCDADCDT
91   DADADTDADADCDTDGDCDA
92   DCDGDADGDGDTDADADCDA
93   DCDADADGDADTDGDGDCDT
94   DADTDGDTDCDTDADADCDA
95   DTDGDADCDTDTDADCDADA
96   DCDADADCDGDTDTDTDTDC
97   DGDADCDCDADCDGDCDTDT
98   DADCDGDADADADTDGDCDT
99   DGDADADADGDADADADADC
100   DADTDCDCDGDTDTDADTDG
101   DADTDGDADCDADTDCDCDG
102   DTDGDADCDADCDTDGDADT
103   DGDADCDCDTDGDCDADCDG
104   DADTDGDCDTDADTDTDCDA
105   DCDADTDGDGDCDTDGDCDC
106   DGDADTDADADTDGDCDADG
107   DTDTDCDCDGDCDADCDTDA
108   DCDTDADCDGDCDTDGDADC
109   DADTDCDTDTDTDADGDCDG
110   DTDADADTDGDGDCDADADG
111   DTDGDADGDGDGDCDADTDT
112   DGDADCDCDTDTDGDADGDT
113   DTDCDGDADADGDADCDTDC
114   DTDGDGDTDCDTDGDADTDG
115   DCDCDTDGDADCDADCDCDA
116   DADGDGDADCDGDTDADADT
117   DCDCDGDCDADTDCDCDTDG
118   DCDADADGDCDGDCDGDTDA
119   DTDCDTDADTDGDADGDCDA
120   DADTDTDADADCDGDADTDT
121   DGDADCDCDTDCDTDGDGDG
122   DADADGDADCDGDCDADGDA
123   DADGDADCDTDTDGDCDTDC
124   DADADTDGDADADTDADCDT
125   DTDGDGDADGDGDADADGDT
126   DCDGDADGDGDADGDTDADC
127   DGDADGDGDADGDGDADTDG
128   DADADGDADGDTDADADTDG
129   DTDCDTDADCDTDADCDCDA
130   DADCDGDTDGDCDADADTDA
131   DCDGDGDTDCDTDGDADCDC
132   DGDCDTDCDADADADCDTDG
133   DTDADCDTDTDTDTDCDTDA
134   DTDADGDCDGDADCDADTDG
135   DGDTDGDCDGDCDTDGDTDG
136   DGDCDTDTDTDADADCDTDG
137   DGDTDCDADCDTDCDGDCDA
138   DADTDGDGDCDADCDADGDC
139   DTDCDADADADGDADADCDT
140   DGDTDADCDGDADADADADC
141   DADADCDADADGDGDCDADA
142   DTDADGDCDTDTDTDADGDA
143   DADTDCDTDGDCDTDGDADG
144   DTDGDADTDADGDADCDTDC
145   DADADGDGDTDCDGDCDTDC
146   DCDTDADGDCDGDADGDTDG
147   DGDCDCDTDTDTDADTDGDA
148   DTDTDADTDCDADCDTDTDT
149   DADCDTDTDADTDGDADGDG
150   DGDADGDTDADADTDGDTDA
151   DTDADTDGDCDTDTDADCDT
152   DADTDCDGDGDTDCDTDADC
153   DTDCDADCDCDGDCDTDCDT
154   DADGDGDTDCDTDADGDCDT
155   DGDTDADGDGDTDGDCDADT
156   DCDCDTDTDTDGDGDGDADA
157   DGDGDCDTDTDTDADGDGDT
158   DGDTDADGDCDTDGDTDADG
159   DGDTDTDCDCDTDADCDTDT
160   DTDADCDCDGDCDTDTDGDC
161   DADTDCDADTDCDADTDADG
162   DGDADADTDCDADTDCDADA
163   DADGDGDGDGDCDADCDTDA
164   DCDGDCDADADADTDGDADT
165   DGDADADGDCDADCDTDADC
166   DGDTDTDADTDGDCDCDADA
167   DTDCDCDADCDADCDGDTDC
168   DCDADADCDGDGDGDGDCDA
169   DADCDCDGDTDADTDGDTDA
170   DCDADCDCDTDGDADTDGDG
171   DGDTDTDCDGDCDADADTDG
172   DADADADCDADADCDGDADA
173   DTDCDGDADADCDGDCDCDT
174   DTDADADGDCDGDTDGDADA
175   DCDTDCDCDGDCDADTDTDA
176   DADCDCDGDCDADADGDADT
177   DTDADADCDADADGDADTDA
178   DGDGDTDTDCDCDGDGDCDT
179   DADTDGDADCDADGDADADC
180   DGDCDADCDTDGDADTDGDG
181   DCDTDTDADADADGDADADA
182   DGDGDTDTDADTDADTDGDC
183   DCDCDADADTDGDGDCDADC
184   DADCDTDADTDADCDGDCDT
185   DGDCDADADADTDCDGDGDC
186   DGDADADTDADGDTDGDADG
187   DADADCDTDTDGDGDCDGDA
188   DGDADGDADADCDADADCDC
189   DTDCDGDADADCDGDCDCDG
190   DCDADADGDGDADCDADADG
191   DADGDADGDGDGDCDGDGDC
192   DGDTDGDGDCDADTDADGDA
193   DCDGDADADADGDGDADADA
194   DADGDGDTDTDADADADGDC
195   DCDADADGDADADADCDTDC
196   DGDCDCDGDCDADCDTDTDG
197   DADADCDADGDGDCDADCDT
198   DADGDCDCDADADCDADCDA
199   DCDTDGDADADCDGDCDTDA
200   DTDCDTDCDADTDADADCDG
201   DADADCDADTDADADADGDG
202   DADCDADCDADADTDGDCDA
203   DADTDGDADADCDADTDTDA
204   DCDCDGDADCDADTDCDADT
205   DGDADADCDGDCDTDADTDC
206   DGDADCDGDCDADADTDCDA
207   DADADGDCDADCDTDGDCDC
208   DADADTDCDTDGDTDGDADA
209   DCDTDTDGDADCDADADGDC
210   DGDTDCDADADGDGDTDADT
211   DGDCDTDTDADTDCDGDADC
212   DTDTDADCDTDGDGDTDCDG
213   DADGDADTDGDGDTDCDADA
214   DCDADGDCDGDADGDADCDG
215   DTDGDTDGDADTDGDGDCDG
216   DADGDCDTDADADCDCDGDA
217   DADCDTDADADADTDCDADG
218   DGDCDADCDTDTDGDADGDC
219   DADTDCDADADGDADTDTDG
220   DGDTDGDGDADCDTDADCDC
221   DTDTDGDADADGDTDGDTDC
222   DTDCDADCDGDGDCDTDGDA
223   DCDGDCDADGDGDGDTDTDC
224   DADADGDADTDGDCDTDCDG
225   DGDTDADADTDGDGDTDCDA
226   DCDTDTDCDTDCDGDGDCDT
227   DGDCDTDTDADTDADGDTDC
228   DADCDCDCDGDCDTDGDCDT
229   DADCDCDTDADADCDADGDA
230   DGDTDGDADTDTDADADGDG
231   DTDGDGDGDCDTDTDTDADA
232   DGDADADADGDADGDGDADT
233   DTDCDADGDGDCDGDCDADG
234   DCDCDTDADTDADCDCDGDC
235   DADTDTDCDTDGDCDCDGDC
236   DADTDGDTDADTDCDADGDG
237   DGDTDCDGDTDCDCDTDGDG
238   DTDADTDCDCDCDTDADADC
239   DGDTDCDTDADCDGDADTDG
240   DTDADCDADGDCDGDCDCDA
241   DCDGDCDTDGDGDADTDGDC
242   DTDADTDADCDGDGDTDGDG
243   DTDADCDTDTDGDADCDGDC
244   DADCDTDTDADADGDGDADT
245   DTDGDCDGDADGDCDGDTDT
246   DTDCDADADCDADADTDGDA
247   DTDGDCDCDCDADTDTDADT
248   DADADADTDADCDGDCDTDG
249   DADGDADTDTDGDCDADADG
250   DCDGDADCDADTDCDADTDT
251   DGDADTDTDGDCDADADTDT
252   DCDGDGDADTDGDADGDCDA
253   DTDGDADTDGDADGDTDTDA
254   DADCDTDGDGDADTDGDGDG
255   DADTDGDGDTDGDADGDTDT
256   DTDGDTDTDGDADADADCDT
257   DTDGDTDADADADCDTDADA
258   DTDCDCDGDCDADADGDTDT
259   DCDTDTDTDGDADGDGDGDC
260   DADTDCDGDCDCDTDCDADT
261   DTDCDGDADCDADTDGDCDA
262   DTDADGDCDGDGDGDADADC
263   DADTDCDADTDGDTDTDCDT
264   DCDADADADTDGDGDADGDA
265   DCDGDTDADCDCDADTDADC
266   DADTDCDADCDCDGDADCDC
267   DCDGDGDTDADTDCDADTDT
268   DCDTDCDGDCDADGDADADG
269   DADADADGDADCDGDGDTDG
270   DGDCDGDCDADTDTDCDADG
271   DCDADTDCDGDADCDCDCDT
272   DGDADGDGDADADCDTDCDA
273   DTDCDADADGDGDADADGDT
274   DCDGDADGDGDADADGDTDC
275   DGDCDADCDGDADCDADGDA
276   DADADGDADADADTDTDGDA
277   DCDCDGDCDGDCDTDADADG
278   DGDCDCDCDGDTDADADADG
279   DADADCDGDTDCDADCDGDA
280   DGDGDGDGDCDGDCDTDTDA
281   DGDADGDGDCDADCDGDCDA
282   DGDADTDTDCDADADADCDG
283   DTDCDGDCDADADCDCDGDC
284   DADADGDGDCDADCDGDTDA
285   DADADGDCDADCDADCDADA
286   DADGDCDTDADADGDCDGDC
287   DGDADADADGDADADTDGDC
288   DTDTDGDCDTDGDCDGDTDG
289   DGDCDGDADTDGDGDGDCDT
290   DGDADADCDGDTDCDADADG
291   DADADCDGDGDCDGDTDADA
292   DCDCDADTDGDADGDGDTDA
293   DGDCDTDGDTDADGDADTDG
294   DTDADCDTDADGDGDADADG
295   DADADCDCDADADTDADADC
296   DGDCDTDADTDGDCDTDCDT
297   DGDGDGDTDCDADADCDADT
298   DGDTDTDCDTDCDTDGDGDG
299   DGDADCDTDTDTDADADGDG
300   DCDGDCDTDTDGDADGDGDA
301   DADCDGDADADTDCDGDCDG
302   DCDTDGDCDADCDTDGDGDC
303   DGDTDADADTDGDCDTDGDA
304   DCDCDGDGDADTDGDGDCDT
305   DADTDCDGDCDTDADADTDG
306   DGDTDCDTDTDADCDGDCDT
307   DCDADADCDADTDTDGDADT
308   DADADGDCDADADCDTDTDG
309   DADCDGDCDADADTDGDTDT
310   DADADTDGDGDGDCDTDGDA
311   DTDADGDTDCDTDTDADTDC
312   DTDTDADCDADGDGDTDCDA
313   DTDCDTDGDCDGDGDGDTDG
314   DGDCDCDTDGDADADTDADG
315   DGDTDADCDGDADTDTDTDA
316   DCDTDADADCDTDGDGDADA
317   DGDADGDGDCDADCDTDADA
318   DADTDGDADADCDADCDGDA
319   DTDTDADADCDADTDCDGDC
320   DTDADADGDADADCDGDADC
321   DTDTDCDTDCDTDGDADCDA
322   DTDCDGDADADCDTDGDGDC
323   DTDGDCDTDADTDCDCDCDG
324   DTDTDCDADADCDADCDTDC
325   DTDGDGDCDTDGDADCDCDA
326   DTDTDADCDGDGDTDGDADG
327   DCDGDTDTDTDADGDCDTDC
328   DGDCDGDADADCDADGDTDT
329   DGDGDCDCDCDTDTDGDADG
330   DCDADTDGDADGDTDCDTDT
331   DADCDGDADGDADTDGDGDG
332   DTDGDADADGDCDADCDGDC
333   DTDTDCDCDGDCDADADGDA
334   DTDGDTDTDTDGDADGDCDG
335   DTDCDADADCDTDTDADADA
336   DGDCDTDGDGDTDGDADGDG
337   DTDTDGDCDGDGDADTDADA
338   DCDGDCDTDGDCDCDGDCDC
339   DADADGDCDCDTDCDTDCDA
340   DTDCDADCDTDADCDCDCDT
341   DADCDTDCDCDCDTDADADG
342   DADTDGDADTDTDGDCDADC
343   DGDCDADTDCDADADCDGDA
344   DCDTDGDGDTDTDTDGDADG
345   DGDADADGDTDGDADADADG
346   DCDTDADADGDCDGDCDGDG
347   DCDADADGDCDGDCDCDCDG
348   DADCDADGDCDCDTDTDCDC
349   DADGDTDTDCDCDTDGDCDA
350   DADGDADADADTDCDADADG
351   DCDCDGDGDADADGDCDCDG
352   DTDADGDCDGDTDADCDADT
353   DCDADCDCDADTDTDADADG
354   DADCDCDADCDTDCDTDGDG
355   DCDTDTDGDCDCDTDADADC
356   DCDADGDTDGDCDTDGDADC
357   DADADTDADCDADADCDCDG
358   DTDTDCDADGDGDCDTDGDT
359   DADGDCDADADGDCDGDCDA
360   DADTDCDGDGDTDCDGDGDG
361   DCDCDADTDTDGDADGDGDA
362   DCDGDADGDGDCDTDCDGDC
363   DTDTDCDGDGDTDCDGDTDA
364   DTDCDCDGDTDGDADCDCDT
365   DTDGDADADGDCDTDADADG
366   DCDADCDTDTDCDADADGDA
367   DADADADADCDGDTDTDGDA
368   DGDGDADADCDADADCDTDC
369   DADADCDADADGDCDGDCDG
370   DTDADGDGDGDCDADCDGDT
371   DCDTDADCDADADGDADADA
372   DGDCDADTDTDTDADTDGDC
373   DADADGDTDTDGDTDCDGDA
374   DGDGDCDTDGDADCDADTDG
375   DCDTDCDTDCDTDADADGDG
376   DGDTDCDTDADCDTDCDGDG
377   DTDGDGDCDGDADGDGDCDG
378   DTDGDGDTDCDTDTDCDGDT
379   DGDGDCDADTDADADGDGDA
380   DADGDADCDTDCDTDADTDT
381   DCDADTDGDTDADGDGDADG
382   DTDADCDGDCDTDGDCDADT
383   DCDGDADGDADTDGDCDTDC
384   DADTDTDGDADGDTDCDADA
385   DCDCDGDGDADADTDGDGDT
386   DTDADGDCDTDTDADCDADC
387   DCDGDCDCDADADADADTDG
388   DCDTDGDGDCDGDTDADGDT
389   DADGDGDTDCDADADGDADC
390   DTDCDTDGDADGDADCDTDA
391   DTDCDGDADADCDTDCDGDC
392   DADCDCDTDGDADADTDADC
393   DGDCDTDGDADGDGDCDTDA
394   DTDCDGDCDADADCDCDCDG
395   DTDGDCDADGDGDTDGDCDG
396   DCDTDGDGDCDTDGDGDCDA
397   DTDCDTDCDTDCDCDGDADT
398   DGDTDTDCDCDADADCDCDT
399   DTDGDCDGDTDADGDTDTDC
400   DCDTDCDCDTDADADGDCDC
401   DGDTDGDGDADCDTDGDGDC
402   DADTDTDADCDTDGDGDTDG
403   DGDTDGDGDCDTDADTDTDG
404   DGDGDCDTDADADCDGDGDT
405   DCDGDTDCDGDTDCDCDTDC
406   DTDGDGDCDGDCDTDGDGDT
407   DGDCDGDTDADCDTDCDADC
408   DADGDTDADADGDADADADG
409   DCDADCDTDGDADTDGDCDG
410   DCDTDADCDGDADADGDADC
411   DGDTDTDTDADCDADTDGDC
412   DCDTDGDADGDGDTDGDTDA
413   DCDADADADGDCDGDADTDT
414   DADADCDADTDTDGDCDGDC
415   DADADADADCDADCDCDGDC
416   DADTDGDGDADADADADTDC
417   DADADCDADADGDADADADG
418   DTDCDCDTDADGDCDGDGDT
419   DCDGDCDCDADADCDGDTDA
420   DADTDCDADCDCDADADGDT
421   DGDGDADADGDCDADTDTDG
422   DTDCDCDGDGDTDCDGDADG
423   DGDADCDADTDCDCDCDTDG
424   DCDGDADTDTDGDADGDCDG
425   DTDGDADADGDADADCDTDC
426   DCDCDGDADTDGDADADADC
427   DCDGDGDADADGDADCDADT
428   DCDGDADCDADTDGDADADT
429   DCDCDTDGDADGDGDCDTDC
430   DTDCDADCDCDGDCDGDTDG
431   DGDADADADCDGDTDGDCDT
432   DGDCDCDGDCDTDGDCDTDG
433   DTDGDTDADCDCDGDCDADA
434   DGDGDADCDADADGDGDCDT
435   DCDGDCDADADGDTDCDTDC
436   DGDCDCDGDTDADTDCDADG
437   DCDCDTDTDGDADGDTDTDC
438   DADTDGDCDTDTDGDADGDC
439   DADADGDCDCDADADTDADA
440   DGDTDTDTDGDCDTDADADC
441   DCDADTDADADGDGDCDCDA
442   DTDCDTDGDGDTDTDCDCDC
443   DTDTDADCDADADCDADTDG
444   DGDADCDTDGDGDCDGDCDG
445   DGDTDCDGDTDGDTDTDTDA
446   DCDGDCDTDGDTDGDTDCDA
447   DADTDGDTDTDCDADADCDC
448   DCDGDCDADADGDGDTDADA
449   DCDGDADTDADTDGDADCDC
450   DADADADGDGDADCDTDGDC
451   DTDTDADCDGDCDTDGDGDC
452   DGDADADADGDGDTDADADA
453   DCDCDADADTDCDGDGDTDA
454   DADGDGDADADGDGDTDTDA
455   DCDTDADCDTDGDGDCDTDG
456   DADADADADTDCDCDADCDG
457   DGDTDGDCDADADADCDTDG
458   DTDGDCDGDGDGDTDGDTDC
459   DGDADTDADADGDGDTDTDC
460   DCDGDTDTDCDCDCDTDGDA
461   DGDCDGDCDADTDCDADADG
462   DTDTDCDADTDTDGDADGDG
463   DADADADADCDCDADCDGDA
464   DGDADADCDADTDCDADTDG
465   DGDCDTDTDGDCDGDCDTDA
466   DADGDTDCDTDCDCDADCDT
467   DGDGDADGDADADCDADCDT
468   DTDGDGDTDGDGDGDCDTDG
469   DADGDCDADADGDADTDTDC
470   DTDCDCDGDTDTDCDTDGDC
471   DTDTDCDCDTDTDGDCDGDT
472   DTDCDTDGDCDTDTDTDGDA
473   DGDTDADCDGDCDTDGDGDG
474   DGDTDADCDADGDCDADCDC
475   DADCDGDGDCDCDTDGDADG
476   DCDTDADTDADADCDTDGDC
477   DTDCDCDCDTDTDCDCDGDC
478   DTDGDGDCDGDTDTDTDGDA
479   DCDGDGDGDTDCDTDTDGDC
480   DTDCDTDGDGDCDADTDCDC
481   DADGDCDADCDTDTDCDTDC
482   DCDGDCDGDADTDGDCDTDC
483   DCDGDADGDADTDGDADGDG
484   DTDADGDGDTDGDGDTDCDG
485   DCDGDCDGDGDTDTDADADC
486   DTDTDGDCDTDTDCDCDTDA
487   DGDTDGDADADADCDCDGDT
488   DTDCDADGDGDADCDADTDC
489   DTDADCDGDGDGDADTDTDG
490   DTDTDGDCDTDADADGDADA
491   DADGDTDCDADADCDGDADG
492   DADTDTDCDTDADCDADADG
493   DCDADGDADCDGDCDADADT
494   DCDADADTDGDGDGDADCDC
495   DGDADTDADADCDGDADADG
496   DTDADGDTDTDADCDCDGDT
497   DGDADCDCDGDADTDGDADG
498   DADADCDADCDTDGDGDTDG
499   DADADADTDCDTDCDTDGDA
500   DGDADADADGDTDCDADADG
501   DCDTDGDGDGDCDADCDTDA
502   DADGDGDCDADCDTDGDGDC
503   DTDGDGDTDCDADADTDGDG
504   DCDTDGDGDCDTDTDADCDG
505   DGDTDGDTDTDADCDTDCDG
506   DCDADGDTDGDTDGDADCDT
507   DADADGDCDGDTDTDCDADG
508   DTDCDADTDGDADCDGDCDT
509   DGDGDCDTDTDADCDGDGDG
510   DTDCDCDADADADGDADGDT
511   DTDCDGDGDCDTDTDCDCDG
512   DTDCDADADCDADADGDTDG
513   DCDTDGDGDADADGDADTDA
514   DCDCDADTDTDCDADGDCDC
515   DADGDCDTDADTDTDGDADT
516   DTDCDCDGDGDCDADADGDG
517   DGDTDCDTDGDADTDGDTDT
518   DCDADCDTDCDADGDCDCDG
519   DADADTDCDADGDGDCDTDG
520   DCDTDGDGDADTDADCDADT
521   DGDGDCDTDADADGDCDTDG
522   DADTDTDTDGDGDGDADADT
523   DCDTDGDTDGDADGDCDGDT
524   DGDADCDGDGDTDGDGDTDA
525   DGDCDTDGDCDGDGDTDTDG
526   DADADGDCDADADTDGDADA
527   DCDTDGDGDCDTDTDADADG
528   DTDCDTDGDCDTDGDCDTDA
529   DADGDCDTDGDCDTDGDGDC
530   DTDGDCDTDGDADGDGDTDC
531   DADADADGDADTDADADGDA
532   DADGDADCDTDGDGDADGDA
533   DGDADTDTDCDTDTDCDGDC
534   DADADGDCDGDTDTDGDCDG
535   DCDTDGDTDGDCDADTDTDG
536   DGDGDTDADADCDTDCDCDT
537   DGDADTDGDGDTDTDTDCDC
538   DCDTDGDTDGDTDGDGDCDA
539   DGDGDADADTDADCDADADG
540   DADADGDCDCDTDADTDTDC
541   DADGDADCDGDCDGDCDTDT
542   DGDADADCDCDTDGDADTDG
543   DTDTDCDCDTDCDGDGDTDC
544   DADGDTDTDCDCDGDCDTDT
545   DADCDADGDCDCDTDADCDC
546   DADTDTDADADCDADCDCDA
547   DADCDADADADGDADTDADG
548   DCDGDADGDADTDTDGDADT
549   DGDCDADCDADCDADADADC
550   DADGDGDADGDTDCDTDGDG
551   DTDADTDCDGDCDTDCDCDT
552   DADADCDTDTDTDGDTDADC
553   DADCDADGDCDCDADADGDA
554   DCDGDGDTDADGDCDCDADC
555   DCDTDTDCDGDTDADADGDA
556   DCDTDGDTDADGDTDGDTDG
557   DGDGDCDADCDADCDGDADG
558   DADADGDTDADCDGDGDADA
559   DTDCDGDADADTDCDTDTDT
560   DTDGDCDADCDTDGDADTDT
561   DCDADCDGDADCDTDCDCDT
562   DTDCDGDGDTDADCDCDADT
563   DTDCDCDGDGDCDTDGDADC
564   DGDCDTDGDCDGDADADCDC
565   DTDGDTDTDCDADADADGDC
566   DADGDTDGDCDGDCDGDADA
567   DADCDTDADTDGDGDTDTDG
568   DADCDADCDADTDADTDGDA
569   DGDTDCDTDTDGDTDGDADT
570   DGDTDADCDTDGDGDCDTDG
571   DADTDTDTDCDTDADCDGDA
572   DCDCDADGDTDTDCDGDCDT
573   DGDADCDCDADGDTDTDGDC
574   DADCDGDADGDTDCDTDCDA
575   DADTDTDGDGDADCDADADA
576   DADTDGDCDCDADGDCDADC
577   DTDTDCDCDGDGDCDTDADA
578   DADGDGDTDADADCDTDTDG
579   DADADCDCDTDCDCDGDTDG
580   DADCDADTDCDTDTDADGDA
581   DGDTDCDGDGDADCDTDTDC
582   DGDCDGDTDTDCDGDCDGDT
583   DADADCDGDCDCDADADADT
584   DCDADADTDADCDGDADCDT
585   DCDADCDTDADTDADGDADG
586   DGDGDADCDADADADCDTDC
587   DADADGDGDTDCDADTDTDC
588   DGDCDADADGDADGDTDGDG
589   DCDCDTDTDTDADTDGDADT
590   DTDGDADCDCDTDTDCDTDT
591   DCDCDGDGDTDTDADADTDA
592   DCDGDADCDTDCDADCDTDA
593   DTDADGDGDADGDADADCDC
594   DTDTDADADGDGDTDTDTDA
595   DADCDTDTDTDADADGDADC
596   DCDCDTDTDADADGDTDGDT
597   DTDADADTDTDADGDADGDA
598   DTDTDTDADADADTDTDADA
599   DADGDADADTDTDADCDTDA
600   DADGDADGDADGDGDADCDT
601   DTDTDADADGDTDADTDGDC
602   DGDTDADADCDTDTDCDGDA
603   DADADADGDADTDGDADCDC
604   DADADADCDGDTDTDCDTDA
605   DADCDCDGDTDADADTDGDC
606   DTDCDGDTDGDADCDTDTDC
607   DGDADGDGDCDADADCDCDA
608   DADADGDGDTDCDGDCDADA
609   DGDTDTDGDADADTDADADG
610   DADCDTDADADGDCDGDTDG
611   DADCDCDGDCDTDCDTDCDA
612   DCDADADGDCDGDTDADGDC
613   DTDGDGDGDADGDGDGDTDC
614   DADGDTDADADGDADTDGDG
615   DGDADCDGDTDTDTDADTDA
616   DTDADGDTDGDGDTDADADT
617   DCDTDGDGDCDADGDCDADT
618   DTDCDADADGDGDCDADGDC
619   DADADCDADADADCDADADG
620   DCDTDGDTDTDCDCDADGDT
621   DTDADGDADCDTDTDADGDC
622   DGDGDTDCDADTDTDTDADT
623   DGDADTDGDADCDTDGDGDT
624   DADTDGDADTDGDCDCDTDA
625   DTDADCDADADGDADADADA
626   DGDADTDTDGDCDADTDADC
627   DGDGDTDTDADCDGDTDADT
628   DTDGDADGDGDADCDADGDG
629   DADGDTDGDGDADADADCDC
630   DTDGDADTDTDGDADTDADC
631   DTDADGDCDADCDCDTDTDC
632   DTDADCDCDADCDCDADCDG
633   DADCDGDADGDGDADCDGDT
634   DTDCDTDGDTDTDCDADADT
635   DADTDGDTDGDTDADCDTDG
636   DADTDTDGDGDTDTDGDADA
637   DCDCDADTDADTDGDTDADT
638   DGDADCDCDADGDTDTDGDA
639   DADGDGDADCDTDGDGDADA
640   DGDTDADADTDADCDGDADC
641   DTDCDADGDTDADTDADGDG
642   DGDADCDADADTDGDCDTDT
643   DADADGDGDTDCDGDCDTDC
644   DTDCDTDADGDGDADGDTDG
645   DGDCDCDTDTDADGDTDCDA
646   DTDTDTDADADCDCDADADT
647   DADGDGDADGDADTDADADA
648   DCDADTDTDADTDGDADTDG
649   DADADCDADTDTDADADGDA
650   DCDTDADADCDCDCDGDTDT
651   DTDADADADGDCDCDGDTDG
652   DTDCDTDTDTDCDGDTDADG
653   DADGDTDCDTDGDCDCDADT
654   DTDADADGDADADGDGDCDT
655   DCDTDGDGDADTDADADCDG
656   DCDTDGDGDGDTDADTDCDT
657   DTDADTDCDGDCDTDGDADA
658   DADTDCDADADGDTDADCDG
659   DADTDGDGDTDGDTDADCDG
660   DCDGDGDGDADADCDADTDC
661   DTDGDCDGDTDADGDADCDA
662   DADTDADCDTDGDCDTDADA
663   DCDADGDTDTDADCDTDGDG
664   DCDTDCDTDCDTDCDGDTDG
665   DTDADTDCDTDADADADADC
666   DGDADTDTDCDCDGDGDCDA
667   DCDTDGDGDADGDCDADCDT
668   DTDADADADCDGDGDGDTDT
669   DTDGDADTDGDTDTDCDGDC
670   DTDGDGDADADGDCDGDTDC
671   DTDADCDTDGDADADCDGDA
672   DTDGDADCDCDGDTDTDGDC
673   DTDTDCDTDADCDADADADG
674   DADTDGDGDCDTDTDTDADT
675   DGDCDTDTDGDADTDGDGDG
676   DGDADADCDTDCDADTDGDG
677   DTDCDADADGDGDGDCDGDT
678   DADGDADCDTDTDTDADADC
679   DADCDADGDGDGDTDCDCDG
680   DGDCDCDTDADCDTDGDCDG
681   DTDADCDCDADADADTDGDG
682   DADCDTDGDADCDADCDGDA
683   DADGDADADCDCDADADGDA
684   DGDTDTDCDCDADTDGDADA
685   DGDADGDTDTDADTDTDCDG
686   DTDTDGDADADCDCDADADT
687   DCDCDGDTDADADGDADADA
688   DGDADTDADADADGDTDTDC
689   DCDCDTDTDTDADADGDCDT
690   DGDCDADCDADCDTDGDGDA
691   DCDADCDCDTDTDCDADCDA
692   DTDADADADADCDTDGDTDA
693   DCDGDCDTDADTDCDCDTDC
694   DCDCDGDCDTDGDCDADCDA
695   DTDCDGDTDGDGDADGDTDC
696   DTDGDGDADGDADADGDADC
697   DTDGDTDGDADTDGDTDCDA
698   DTDGDADCDGDTDTDGDCDT
699   DCDADTDGDCDADGDGDADA
700   DCDADCDGDTDTDADADGDA
701   DADCDADTDGDCDTDGDCDC
702   DTDCDTDGDCDTDADCDADG
703   DGDADADTDADCDTDTDCDC
704   DCDTDGDADADADTDCDGDA
705   DADTDGDGDCDADADGDCDG
706   DGDCDTDGDADADTDCDTDT
707   DADCDGDADGDGDTDCDTDA
708   DCDGDADTDADTDGDGDTDA
709   DGDADADCDTDADCDADGDC
710   DADADCDTDGDTDADCDGDA
711   DGDCDADGDADADGDCDGDA
712   DGDCDADGDADADGDGDCDC
713   DADTDGDADGDGDGDTDCDT
714   DCDADTDTDGDTDGDADADA
715   DGDADCDCDCDGDADTDGDT
716   DGDTDADTDCDTDADTDADA
717   DGDCDGDCDGDGDTDADADG
718   DADADADTDCDTDGDGDCDT
719   DGDGDTDGDGDADADADADT
720   DGDADADADCDCDTDGDADG
721   DADADCDGDADADGDCDTDG
722   DADCDGDGDTDADTDCDADT
723   DTDCDADGDGDGDTDCDTDG
724   DGDTDADTDGDGDGDGDTDA
725   DCDADADADADGDGDTDCDT
726   DGDGDCDTDADADTDGDADA
727   DGDGDTDADADADGDTDGDA
728   DTDTDGDGDTDTDTDTDGDA
729   DGDGDTDGDCDTDTDCDTDT
730   DGDADGDADGDTDGDGDTDC
731   DGDTDTDTDADGDTDTDADA
732   DCDGDCDCDADCDGDADADT
733   DADTDCDTDCDTDCDGDCDG
734   DCDCDTDTDADADTDGDGDA
735   DTDGDADGDTDTDCDADCDT
736   DGDADGDADCDADGDTDADA
737   DADADGDADGDGDCDCDADC
738   DCDCDTDADADGDTDCDADA
739   DTDGDGDGDGDADTDTDCDT
740   DTDTDADGDCDCDCDADTDA
741   DCDGDGDTDADTDTDGDGDC
742   DGDADCDADADCDGDADTDG
743   DCDTDTDGDTDADCDTDADT
744   DTDADADCDCDCDTDTDADC
745   DGDADTDGDGDCDTDGDGDG
746   DCDGDTDGDTDCDADADADT
747   DTDADGDCDTDADCDADTDG
748   DGDADGDGDADADADCDADC
749   DCDTDGDADTDGDGDCDTDC
750   DTDTDTDGDCDGDGDCDADC
751   DCDCDADTDCDGDTDTDCDG
752   DTDADADTDGDTDTDCDCDG
753   DTDGDGDCDADCDCDGDADG
754   DGDADCDADADCDCDCDTDC
755   DADADGDADGDADADADADT
756   DGDTDADADTDCDADCDADC
757   DTDGDGDCDTDCDADCDCDT
758   DTDCDGDGDGDTDGDGDGDC
759   DCDTDTDTDCDTDGDCDGDT
760   DTDTDADTDADADGDGDADG
761   DADCDADCDTDTDTDADTDG
762   DTDTDTDADADGDADADGDG
763   DTDTDGDGDTDADADADTDT
764   DCDCDTDTDGDCDGDGDCDT
765   DTDTDGDGDCDADGDCDTDA
766   DTDCDCDTDGDADCDGDCDT
767   DTDGDCDGDTDADTDADTDT
768   DCDTDTDGDCDGDGDTDADT
769   DADCDCDCDTDCDADADGDT
770   DADGDCDADCDTDADGDTDA
771   DGDTDADGDTDTDGDGDCDG
772   DCDTDTDGDTDTDADCDTDT
773   DADGDCDGDGDCDADGDTDG
774   DTDGDTDGDCDTDTDGDCDG
775   DTDGDTDGDGDADGDTDADT
776   DADGDTDTDADADCDTDGDG
777   DTDADADTDADCDGDADCDT
778   DCDADCDTDADADADGDGDA
779   DGDGDTDADCDADCDADCDC
780   DADTDGDADTDGDTDADCDT
781   DTDADADTDGDCDCDADTDT
782   DADCDTDCDADTDCDGDTDC
783   DADTDTDGDTDADGDGDADT
784   DGDCDCDTDTDGDCDGDCDT
785   DCDCDADCDTDGDTDADGDC
786   DGDADTDGDADTDGDADTDA
787   DTDGDCDCDADGDADTDGDG
788   DTDCDADCDGDCDTDTDADA
789   DTDADCDGDADCDTDCDADC
790   DTDADADADGDGDADGDADC
791   DADCDTDADTDADTDGDTDT
792   DTDCDGDADCDTDTDCDADT
793   DTDADCDADADCDADADADA
794   DGDCDGDTDTDADADGDADA
795   DTDTDTDCDADCDGDGDTDT
796   DCDGDCDCDGDTDGDCDTDG
797   DADCDCDGDTDTDCDADADT
798   DCDGDTDADTDGDTDGDCDG
799   DADGDCDGDADGDCDGDCDC
800   DGDADGDCDTDADADGDADT
801   DADCDCDTDCDTDTDADTDT
802   DGDGDTDADADCDADCDADG
803   DTDTDCDCDTDTDTDGDGDC
804   DADCDCDGDADGDCDGDTDC
805   DCDADCDADTDCDADTDTDA
806   DTDCDADCDCDCDGDTDGDG
807   DTDGDADCDTDTDTDGDADG
808   DADADADGDCDADADTDADG
809   DADCDADADGDADADADCDG
810   DTDCDCDGDGDTDTDCDTDT
811   DADGDTDGDTDGDGDCDADG
812   DTDGDADCDCDCDGDCDTDT
813   DCDCDCDGDTDTDCDGDTDC
814   DCDGDTDCDTDGDTDTDADC
815   DTDCDADADADCDGDADADT
816   DCDADADGDGDADGDGDTDG
817   DTDTDCDTDGDADTDGDGDG
818   DADCDTDGDTDTDADGDADT
819   DGDGDTDGDADADGDCDCDT
820   DGDGDGDADADADADADGDA
821   DADADADCDCDCDGDCDCDA
822   DGDTDADCDADADGDCDADA
823   DCDTDGDGDGDTDGDTDADT
824   DADGDCDTDTDGDCDTDTDA
825   DGDADGDADADADGDADTDG
826   DADCDCDGDTDTDADTDCDC
827   DADCDADCDADCDCDTDGDT
828   DADADCDADADADGDGDADG
829   DCDTDADADCDGDADTDADT
830   DGDADCDCDGDADADCDGDT
831   DGDADADCDADADGDADGDA
832   DTDGDADTDCDADTDTDADA
833   DGDTDTDGDADTDADGDADC
834   DADADTDADADTDGDADADG
835   DGDTDCDGDCDCDCDADGDA
836   DTDGDADTDTDTDGDADADT
837   DGDGDCDTDGDCDGDGDTDA
838   DTDTDCDTDCDTDGDCDTDC
839   DCDADADTDGDTDCDCDCDT
840   DTDGDCDCDADCDCDTDCDT
841   DGDCDCDCDCDGDCDADADA
842   DTDADADCDGDADTDCDADA
843   DADADGDADTDADADCDCDT
844   DTDADGDGDTDGDADADADT
845   DCDCDGDADGDCDGDADTDG
846   DGDADCDCDCDADCDGDTDA
847   DADADCDCDADCDADTDCDT
848   DGDADADTDADADADCDCDT
849   DGDADGDGDTDADADCDTDC
850   DCDTDADCDADGDADTDGDA
851   DCDCDADGDCDCDTDTDCDC
852   DGDCDTDGDADGDADCDADA
853   DTDCDGDADADGDGDTDGDT
854   DCDADCDTDADADGDCDCDT
855   DTDCDCDCDADCDTDADCDA
856   DTDGDCDTDGDTDTDTDGDA
857   DCDGDADCDADTDTDGDADG
858   DGDCDTDADTDCDGDADADG
859   DTDGDADTDTDGDCDTDCDG
860   DTDTDCDADADTDGDADCDC
861   DGDTDTDGDADGDCDADGDT
862   DTDCDADADGDGDGDADTDA
863   DCDTDGDCDTDTDCDGDGDT
864   DADADCDADTDCDTDTDADA
865   DADGDTDADCDADGDADCDT
866   DADCDGDTDGDCDTDGDGDT
867   DADADGDADADGDTDCDADG
868   DADGDTDTDADGDCDGDTDA
869   DCDTDTDADGDADGDADADA
870   DGDADCDCDTDADGDCDGDA
871   DADADGDCDADGDADCDTDT
872   DCDTDADTDADADADGDADA
873   DCDTDCDTDTDTDGDADGDA
874   DADADCDADTDADADGDGDA
875   DTDADADADTDGDTDTDADT
876   DGDCDADTDADADCDTDTDC
877   DADADGDTDCDADADCDCDC
878   DCDADCDCDTDGDCDCDGDA
879   DCDADGDCDCDTDADTDCDT
880   DGDADTDGDADCDTDTDCDA
881   DCDADTDCDTDTDGDCDTDC
882   DADGDADGDTDGDGDTDGDC
883   DCDGDADADADGDADTDGDT
884   DGDGDGDADADGDADGDADC
885   DADTDTDCDGDADCDGDADT
886   DGDCDGDTDADCDADTDCDA
887   DADGDCDTDGDTDADTDGDA
888   DADCDTDTDTDGDGDADADA
889   DTDCDGDADGDADGDGDTDC
890   DADADTDGDADCDTDADTDG
891   DTDCDADADADCDGDTDADA
892   DADTDADCDADGDGDTDTDC
893   DADCDTDTDADGDTDGDTDG
894   DGDADCDADADTDADADGDA
895   DADGDTDTDTDTDGDGDGDC
896   DTDADCDCDGDTDADGDADG
897   DTDCDCDTDCDGDGDADGDC
898   DADTDTDCDCDTDTDCDGDA
899   DGDGDTDTDCDCDADADTDC
900   DTDADCDGDCDTDGDADGDA
901   DCDCDCDTDADGDADCDGDA
902   DADGDCDTDCDTDGDGDADG
903   DTDTDADGDCDCDGDADADT
904   DGDGDCDADADTDADCDGDT
905   DTDCDCDGDGDCDTDGDGDC
906   DTDTDTDGDADGDGDTDTDA
907   DCDTDCDGDTDGDTDGDCDG
908   DTDCDCDTDTDGDTDGDTDA
909   DGDCDADCDCDGDADADGDT
910   DADADTDADCDGDADCDTDC
911   DADCDTDADTDTDADGDGDG
912   DADADGDADCDTDCDCDCDT
913   DCDTDGDADGDADADADCDC
914   DADADADCDGDADADADCDC
915   DTDADADADGDGDADGDADT
916   DTDADADCDADTDTDADTDG
917   DGDCDTDADADGDADADGDA
918   DTDTDTDTDCDADCDCDTDC
919   DTDGDCDGDCDTDGDGDGDT
920   DADCDCDGDCDTDGDADADC
921   DCDTDTDADCDGDCDTDTDA
922   DCDADTDCDGDCDCDADADG
923   DCDCDGDGDADCDTDADCDG
924   DGDCDADADCDGDADADGDA
925   DGDCDGDTDGDGDCDTDTDT
926   DGDGDGDADADCDCDCDTDC
927   DGDTDGDGDTDGDTDCDTDA
928   DTDADADADGDTDTDGDADC
929   DCDTDGDADCDTDADTDTDC
930   DCDCDADADCDADADADGDA
931   DCDCDCDGDCDGDCDTDGDC
932   DCDADGDCDGDTDADTDGDG
933   DTDCDGDADTDGDADADADT
934   DCDGDTDGDADADGDTDGDT
935   DCDADCDGDADADGDADGDG
936   DCDTDTDADTDGDCDTDGDC
937   DTDGDCDCDGDTDTDGDADG
938   DGDADADTDADCDGDADADG
939   DCDTDADADTDCDCDADCDC
940   DTDGDCDTDGDTDADGDCDT
941   DCDGDTDGDGDTDADADGDA
942   DADADCDCDGDCDTDGDADA
943   DADCDCDGDTDADTDGDADG
944   DGDGDTDGDADCDADTDGDC
945   DCDGDTDTDCDTDTDCDGDA
946   DTDADADCDGDGDTDGDADC
947   DGDGDTDADCDGDADCDTDA
948   DCDCDTDTDTDADADGDTDT
949   DCDADADADTDGDCDTDADC
950   DGDCDGDTDCDTDTDTDCDC
951   DADADGDADCDADADGDADA
952   DGDADCDCDADADADGDADG
953   DADCDCDADADGDCDADCDA
954   DTDCDADADTDCDTDGDGDT
955   DTDGDTDGDGDTDTDGDADC
956   DTDCDADADADADGDGDTDA
957   DADGDADADGDADTDGDGDA
958   DADGDADCDGDTDTDCDCDG
959   DADTDTDADTDCDGDGDTDG
960   DGDTDGDGDCDTDCDTDADA
961   DGDCDTDGDADADADGDTDT
962   DADADADTDADTDTDCDTDC
963   DTDGDGDTDTDCDCDADTDA
964   DCDADADGDTDGDGDADADC
965   DADCDTDGDCDTDGDTDADG
966   DGDTDGDCDGDADGDCDGDT
967   DTDADADGDCDTDGDCDADA
968   DCDTDGDGDADADTDCDCDG
969   DTDGDADTDGDCDTDGDGDT
970   DCDGDADADCDTDGDGDCDT
971   DADCDCDTDTDTDGDGDTDG
972   DGDCDGDGDTDGDADADGDA
973   DCDGDADTDTDGDGDGDCDT
974   DGDADCDGDADADGDTDTDG
975   DADADGDADGDADADCDGDG
976   DCDTDADTDGDTDTDGDCDC
977   DTDCDTDGDGDTDTDCDTDG
978   DCDCDADADADGDCDGDADG
979   DCDADADADCDCDADCDGDC
980   DGDADCDGDADADGDADADA
981   DGDCDTDGDGDGDADCDGDA
982   DADGDADCDGDADCDGDADA
983   DGDADGDTDCDCDGDADGDG
984   DADADGDCDADGDADCDGDA
985   DADGDADCDGDGDADGDADC
986   DTDTDCDTDADADGDTDGDG
987   DADADCDTDGDCDGDGDGDA
988   DGDADADADADTDCDCDTDT
989   DGDADGDCDGDADADTDCDA
990   DADGDGDTDGDADCDTDTDC
991   DCDTDCDTDGDGDGDTDGDT
992   DTDGDGDGDADGDTDGDGDC
993   DADGDGDGDCDGDCDTDADC
994   DGDADADCDADADTDADADA
995   DGDGDGDTDADCDGDGDGDC
996   DADGDGDTDGDTDGDGDTDG
997   DCDADGDCDADADTDADCDC
998   DGDGDADADADGDGDTDTDG
999   DTDCDTDADCDTDGDTDCDA
1000   DTDCDGDCDGDTDADADTDG
1001   DTDCDTDADADTDGDCDTDC
1002   DCDGDADADADGDGDTDTDC
1003   DTDADCDCDGDTDCDCDTDG
1004   DCDADCDTDCDCDTDGDTDG
1005   DADTDADADTDCDCDADTDT
1006   DADTDGDTDTDGDTDADADC
1007   DCDCDTDGDADADCDADCDC
1008   DTDADTDCDCDADTDADGDG
1009   DADADCDTDCDCDADADADA
1010   DGDADGDADADCDTDCDCDA
1011   DCDTDGDADCDADTDGDGDT
1012   DADADADTDADADGDGDGDT
1013   DCDGDCDTDCDADCDADCDA
1014   DADGDGDGDGDTDADTDADA
1015   DADCDTDTDTDCDADGDADC
1016   DGDADADGDADCDGDTDADA
1017   DTDGDGDCDADADTDCDADT
1018   DGDGDADGDTDCDCDADGDC
1019   DGDADGDTDCDCDADADTDG
1020   DTDADTDCDCDTDTDADGDC
1021   DTDCDGDCDADCDCDTDADT
1022   DGDGDTDGDTDCDTDCDCDC
1023   DADADCDADGDADCDTDADT
1024   DTDTDGDTDGDADTDADTDA
1025   DCDGDCDADADADGDGDGDA
1026   DGDGDCDGDADCDADTDGDG
1027   DCDADGDGDTDTDADCDGDG
1028   DCDGDCDTDADADADGDGDA
1029   DADTDCDCDGDADADADGDG
1030   DTDTDGDGDADGDCDGDTDT
1031   DTDCDGDCDTDCDTDGDGDC
1032   DCDTDADGDADGDGDADCDA
1033   DADGDGDTDTDTDCDADADA
1034   DGDCDADGDTDTDGDGDADA
1035   DTDCDADADADADGDGDTDA
1036   DTDTDADADADTDTDCDGDA
1037   DGDTDADTDGDADADGDADG
1038   DTDGDGDADADADGDTDGDC
1039   DCDTDTDADTDGDTDADADT
1040   DTDCDCDGDGDCDGDADGDC
1041   DADADTDCDADCDADCDTDT
1042   DADCDADCDTDCDCDADGDA
1043   DCDTDTDCDTDTDADCDTDT
1044   DCDCDADADADCDGDGDTDA
1045   DTDADTDTDCDGDTDTDGDA
1046   DGDADCDADADADGDGDGDT
1047   DCDTDGDTDGDGDGDADADA
1048   DGDCDGDADTDGDADTDADG
1049   DADADADGDADADGDCDADC
1050   DTDTDADTDTDADADTDTDA
1051   DGDGDGDADGDCDADGDCDA
1052   DCDCDCDCDGDADGDCDTDA
1053   DGDADCDADTDCDCDGDTDA
1054   DTDTDGDTDCDTDTDCDTDC
1055   DADADGDCDTDCDADCDGDT
1056   DADCDTDADADGDTDTDADT
1057   DADCDADADADGDGDTDTDC
1058   DTDCDCDADADCDGDTDCDT
1059   DTDADTDGDGDADGDADGDT
1060   DTDCDTDGDCDGDADADADA
1061   DGDCDADTDGDGDTDADTDT
1062   DADADGDTDTDCDGDCDTDG
1063   DADTDADADADCDTDGDADT
1064   DADCDCDTDGDCDTDGDADG
1065   DTDGDGDADTDADADADGDG
1066   DADADCDCDCDADADGDADA
1067   DGDGDADGDGDTDCDCDCDC
1068   DTDTDTDGDADTDADGDADT
1069   DTDADADADADADGDGDADA
1070   DADGDGDADGDGDADADADG
1071   DADADADTDADADTDGDGDC
1072   DTDCDGDTDGDTDADCDADG
1073   DTDTDTDADADADCDADADC
1074   DGDTDGDADADTDCDTDADC
1075   DTDGDADCDGDCDADADTDC
1076   DTDTDTDGDTDTDCDADCDT
1077   DGDCDTDCDGDGDCDTDADC
1078   DCDADADGDCDCDADADGDT
1079   DCDADGDADADTDGDTDTDG
1080   DGDTDGDTDCDCDGDTDGDA
1081   DGDADTDTDCDGDCDCDADG
1082   DTDGDGDCDADCDADADADG
1083   DADGDCDADGDGDGDTDTDG
1084   DGDCDTDCDGDADTDGDTDG
1085   DGDGDADTDADCDCDADCDT
1086   DTDTDADTDCDADTDCDADA
1087   DGDCDGDADGDADCDGDGDT
1088   DADCDTDGDTDGDGDADGDG
1089   DCDADGDGDADCDGDADGDA
1090   DTDGDADGDADTDGDGDCDT
1091   DGDTDADGDGDCDTDCDTDC
1092   DADCDGDCDTDADADGDGDG
1093   DTDTDADCDADADCDCDADC
1094   DADADCDTDCDTDADTDCDG
1095   DGDCDGDTDCDTDGDCDCDT
1096   DTDGDTDTDGDGDTDGDGDT
1097   DADTDCDGDADCDGDADTDA
1098   DADADGDGDTDADADGDTDT
1099   DCDGDADCDGDCDTDADADC
1100   DTDTDTDADCDGDCDCDADG
1101   DCDCDCDADADADTDGDCDA
1102   DADTDCDCDCDTDTDCDGDC
1103   DTDCDADCDTDGDCDTDTDG
1104   DTDCDADCDADCDTDGDCDT
1105   DGDGDCDTDADADGDTDADC
1106   DGDADADGDGDCDGDCDTDG
1107   DTDGDCDTDTDCDGDCDGDC
1108   DCDCDADTDCDADTDGDADG
1109   DGDTDGDGDCDGDCDCDGDA
1110   DADGDGDCDTDTDGDCDCDC
1111   DTDTDCDGDTDTDCDGDADC
1112   DCDTDTDADADGDCDGDTDT
1113   DGDGDTDGDGDGDADGDADA
1114   DGDADADCDGDADADCDTDG
1115   DGDTDCDADCDTDTDCDTDG
1116   DADCDCDGDTDGDGDADTDA
1117   DADTDTDADADTDTDGDADA
1118   DCDTDCDADCDTDADADADG
1119   DGDGDADGDADCDCDADCDA
1120   DGDCDGDGDTDTDTDCDCDC
1121   DTDTDTDGDTDTDCDGDCDA
1122   DTDTDGDGDADGDGDTDCDA
1123   DADADTDADADTDGDCDGDC
1124   DADADGDTDCDTDTDADTDA
1125   DADADCDADADTDTDCDTDA
1126   DTDADADGDGDCDTDCDCDG
1127   DADGDGDADGDGDCDADTDA
1128   DTDCDCDADADGDTDGDTDG
1129   DGDGDADGDGDCDADGDCDC
1130   DADADTDGDGDGDCDCDTDA
1131   DTDADCDCDADADADADGDG
1132   DTDTDADTDTDADTDADTDA
1133   DGDADCDCDADCDADTDTDG
1134   DADCDGDGDCDADADTDCDC
1135   DADCDTDCDADADCDGDADC
1136   DGDCDCDTDTDADGDADCDA
1137   DADTDCDTDCDCDGDTDCDT
1138   DGDGDCDTDCDTDCDCDCDA
1139   DADADADGDADADADADCDT
1140   DCDADTDGDGDADADCDADT
1141   DGDADADGDADCDTDCDCDA
1142   DADADGDADGDCDADADTDA
1143   DCDCDTDCDADGDGDADCDT
1144   DADADADGDGDGDADCDTDG
1145   DADGDTDTDGDGDADGDCDA
1146   DADGDGDADADADGDGDGDA
1147   DGDADTDGDTDGDGDADGDA
1148   DGDGDCDADCDTDGDTDADA
1149   DCDADGDCDTDGDADGDGDG
1150   DTDADADADCDADGDCDADT
1151   DADADCDTDTDTDCDGDTDA
1152   DGDTDADGDADGDADTDCDT
1153   DADTDTDGDGDADADGDTDC
1154   DGDTDTDGDCDGDTDGDGDA
1155   DTDTDTDADTDADGDADADC
1156   DTDADGDGDADGDGDGDADA
1157   DTDTDGDCDADTDGDGDADC
1158   DADADTDTDCDGDCDADCDG
1159   DADTDTDCDCDGDADTDADG
1160   DTDGDTDADTDTDTDCDTDT
1161   DTDADCDCDADCDADTDTDC
1162   DCDTDTDGDTDGDADCDADA
1163   DCDTDGDTDGDGDGDADGDT
1164   DADGDTDGDADTDGDGDGDA
1165   DADCDTDCDGDCDTDGDTDT
1166   DCDTDCDTDGDADCDGDGDA
1167   DCDADCDADCDGDTDTDCDT
1168   DGDCDTDADCDGDTDADTDG
1169   DCDGDADGDADADGDTDGDG
1170   DADCDTDGDCDTDGDGDTDA
1171   DADTDGDADADGDADCDADC
1172   DTDADADADGDADGDADGDG
1173   DGDCDTDTDCDADADADADC
1174   DGDGDADADADCDCDCDTDC
1175   DADGDGDADGDGDTDADADA
1176   DCDCDADADTDGDADCDTDT
1177   DADCDADADCDGDTDGDTDG
1178   DGDADADCDTDTDCDGDGDG
1179   DGDADADTDCDCDADADTDG
1180   DGDADCDGDCDTDADCDTDC
1181   DCDGDCDGDTDTDADADCDT
1182   DGDCDGDADGDADGDGDADA
1183   DTDCDTDCDCDADADGDGDA
1184   DADADCDCDTDGDTDCDADG
1185   DADADGDGDCDTDGDGDCDT
1186   DADCDTDGDGDADTDTDGDC
1187   DCDADADADGDTDADGDADC
1188   DGDGDTDGDTDGDADTDGDT
1189   DADCDCDADADGDTDGDGDC
1190   DTDGDADCDTDADTDCDGDG
1191   DGDADCDCDADGDADADCDG
1192   DGDCDADADCDADTDTDGDT
1193   DGDADGDTDCDADGDADADG
1194   DGDTDTDCDGDADGDADTDA
1195   DADADGDADTDADADGDADA
1196   DCDTDTDTDADADGDADCDC
1197   DADCDTDGDGDTDADGDTDC
1198   DADCDADADGDADGDTDGDA
1199   DCDGDCDTDCDTDGDTDTDC
1200   DGDGDGDADADGDCDADCDT
1201   DTDGDTDGDGDADADTDGDG
1202   DTDGDGDTDADADGDADADG
1203   DADTDTDGDTDCDGDTDTDA
1204   DCDADGDADADGDGDTDGDA
1205   DADADTDCDGDADCDADTDG
1206   DCDTDTDADCDCDGDTDGDA
1207   DTDGDGDADADCDTDTDCDA
1208   DADGDADCDTDGDTDADADG
1209   DTDADTDCDCDTDGDTDADG
1210   DTDGDTDCDGDTDTDGDGDG
1211   DTDCDADCDGDGDTDGDCDC
1212   DTDCDTDGDCDCDGDCDTDA
1213   DADGDADADGDADCDADTDG
1214   DCDGDCDTDGDCDCDADADC
1215   DTDADCDGDADADTDADCDT
1216   DTDTDGDADCDCDADGDTDT
1217   DCDGDADADCDADGDADTDT
1218   DADTDCDTDTDADADTDGDT
1219   DTDCDGDADTDADTDGDGDA
1220   DCDGDADADGDCDADGDGDG
1221   DCDGDCDADADADGDCDADG
1222   DTDCDGDADADGDADGDGDC
1223   DTDGDCDADCDADGDGDTDT
1224   DCDTDADCDCDTDGDCDTDG
1225   DGDTDADADGDGDTDADCDG
1226   DADGDTDGDGDCDADGDTDT
1227   DCDTDTDCDCDGDTDGDTDA
1228   DADGDGDADTDGDCDADADA
1229   DCDGDADGDTDGDTDCDADC
1230   DCDTDADADADTDGDGDTDC
1231   DADCDGDADCDCDGDTDGDA
1232   DADADTDCDADTDGDGDADG
1233   DCDADADGDTDGDTDGDGDA
1234   DADTDGDCDTDGDGDTDCDC
1235   DTDTDGDGDADTDTDCDCDT
1236   DGDADTDGDGDTDGDTDGDG
1237   DTDADTDCDGDGDCDTDCDT
1238   DTDTDCDGDTDTDADCDGDT
1239   DGDADADCDGDADADTDCDC
1240   DGDTDGDADGDCDADCDCDT
1241   DADTDCDGDTDCDCDGDADG
1242   DGDADADTDCDADGDTDADG
1243   DGDTDTDTDADCDTDTDTDT
1244   DCDADGDTDGDGDCDTDGDC
1245   DADCDTDGDGDTDADTDCDA
1246   DADCDGDADTDADADGDADC
1247   DCDTDTDADGDGDTDGDCDC
1248   DCDGDTDGDGDTDGDGDTDG
1249   DADADGDTDCDADTDTDADT
1250   DGDGDTDCDADCDTDTDCDC
1251   DGDGDTDTDCDCDGDGDTDA
1252   DTDGDGDGDTDADADGDTDC
1253   DADADCDGDTDTDCDGDTDC
1254   DCDGDTDCDADADCDADADG
1255   DCDTDCDTDADCDADADTDG
1256   DGDGDGDCDADCDADGDCDG
1257   DADTDGDGDGDCDADADGDA
1258   DADGDGDTDADGDGDCDTDT
1259   DADGDCDGDADTDGDCDTDT
1260   DGDADGDGDADGDTDCDCDG
1261   DTDTDGDADGDGDADGDADC
1262   DCDGDCDTDGDADGDGDADC
1263   DCDTDTDADTDADGDGDTDC
1264   DTDADCDADCDADADCDCDG
1265   DTDGDTDCDCDGDADCDTDG
1266   DADGDADCDADADTDCDCDG
1267   DADCDTDCDADCDTDADADA
1268   DGDADGDADGDADGDADTDT
1269   DADTDTDGDADGDADADCDG
1270   DGDTDADADGDTDTDCDGDA
1271   DCDCDADADTDGDGDTDTDC
1272   DGDADTDGDADADCDTDGDT
1273   DTDCDGDGDCDADADCDGDA
1274   DTDADCDGDTDTDCDCDADT
1275   DCDTDADTDADTDGDADCDT
1276   DCDADTDTDCDGDCDCDGDA
1277   DGDGDCDTDGDADGDADCDG
1278   DGDADTDADGDADCDTDGDC
1279   DTDCDGDCDTDADADGDCDT
1280   DGDGDCDCDTDADCDADTDG
1281   DCDGDCDTDCDADGDGDCDT
1282   DTDGDGDGDCDTDGDTDGDA
1283   DCDGDTDADADTDCDADTDT
1284   DCDTDADGDADCDCDADCDA
1285   DTDCDTDCDADADTDCDGDT
1286   DCDGDTDADTDCDCDGDCDT
1287   DTDCDTDGDGDTDGDADADT
1288   DCDCDGDADTDGDADGDCDG
1289   DTDADADGDADTDGDADTDT
1290   DGDADCDADADCDCDTDGDA
1291   DTDGDADCDCDADADGDCDT
1292   DCDADADADGDGDGDTDTDC
1293   DGDCDTDADADGDTDCDADA
1294   DCDTDGDGDGDGDTDGDGDT
1295   DGDCDTDGDGDTDCDGDTDA
1296   DADTDTDTDGDTDCDADCDC
1297   DTDTDADADGDADADCDCDC
1298   DADGDADCDADADADGDGDT
1299   DADADADGDCDADCDADTDG
1300   DADGDGDADADGDGDTDCDG
1301   DCDCDCDCDGDTDTDTDCDT
1302   DADTDTDADCDTDGDADCDC
1303   DTDADCDGDTDGDGDTDTDC
1304   DTDGDGDCDGDCDADCDTDA
1305   DCDGDCDCDADADCDTDADT
1306   DCDTDGDADTDADCDTDADT
1307   DTDADTDTDGDCDCDCDTDT
1308   DGDADGDCDGDTDADADTDC
1309   DADGDCDADADGDGDCDGDA
1310   DTDADTDGDCDCDTDADADC
1311   DCDTDTDGDTDCDCDTDCDG
1312   DTDTDCDGDTDADTDTDCDT
1313   DCDADADGDTDGDCDCDGDC
1314   DTDTDTDADCDTDGDGDTDG
1315   DADTDADCDTDGDGDTDADT
1316   DCDGDCDTDGDGDCDTDADC
1317   DADTDGDGDADADTDADCDA
1318   DADCDADADGDGDADADADC
1319   DCDGDGDADTDGDGDCDTDT
1320   DGDADADCDCDADTDCDADA
1321   DGDTDTDADCDTDCDADGDG
1322   DGDGDADADGDADADGDADG
1323   DTDCDADCDADCDTDCDADG
1324   DADGDTDCDADADCDADGDA
1325   DCDTDGDGDTDCDCDADADC
1326   DGDADCDADCDTDGDADCDT
1327   DTDCDTDGDADCDADGDGDA
1328   DTDTDCDTDTDGDADTDGDA
1329   DCDTDTDTDCDCDADGDADC
1330   DGDADCDTDADCDGDADGDA
1331   DADGDTDTDTDCDGDCDTDG
1332   DGDADGDADGDTDCDCDCDA
1333   DTDTDCDTDADADTDADCDG
1334   DADCDTDCDADCDTDADADA
1335   DGDGDADGDADCDADCDADC
1336   DCDADTDGDTDTDCDADADA
1337   DCDTDGDADTDTDADADGDA
1338   DADGDTDTDADGDGDCDCDA
1339   DADCDTDGDCDTDGDGDTDT
1340   DCDGDTDADTDGDTDADCDA
1341   DADCDGDTDGDGDADADGDC
1342   DCDADADGDCDGDADCDTDG
1343   DADADCDGDADTDGDADGDG
1344   DCDTDCDGDTDADADADGDA
1345   DGDGDCDCDADCDADCDADG
1346   DTDCDADCDGDCDGDCDTDC
1347   DTDGDGDCDGDADTDTDCDG
1348   DCDTDCDCDADADCDGDADA
1349   DCDTDGDGDCDTDGDADCDA
1350   DGDTDGDCDADTDCDCDADC
1351   DTDADADADGDTDTDADCDC
1352   DGDADGDGDCDTDGDCDCDC
1353   DGDTDGDTDGDGDCDADADA
1354   DCDCDADADGDCDTDCDADA
1355   DCDADGDCDTDTDTDCDCDA
1356   DADADTDTDCDTDTDTDGDA
1357   DGDTDADADTDCDADADADC
1358   DADGDGDADGDADADADCDC
1359   DADTDTDADTDGDTDCDTDA
1360   DADCDGDTDADGDCDTDGDA
1361   DADADCDTDADTDCDCDGDT
1362   DCDTDADTDCDCDGDADTDA
1363   DCDADGDCDTDGDADCDCDA
1364   DGDTDGDGDADADCDCDGDT
1365   DCDGDADGDTDCDCDADCDA
1366   DTDCDADADCDGDTDTDCDG
1367   DCDADADCDGDGDTDADADG
1368   DGDCDGDADCDTDADTDGDG
1369   DTDTDTDADCDCDGDCDTDG
1370   DGDADADGDGDADCDTDCDT
1371   DADADGDTDCDCDTDCDTDA
1372   DADGDADADTDCDADCDADC
1373   DTDCDADGDCDGDTDADTDG
1374   DADCDGDTDTDGDADCDADG
1375   DADTDGDADGDCDADADGDC
1376   DADCDTDGDCDGDTDCDTDG
1377   DGDTDCDADADTDGDCDGDC
1378   DTDTDADCDCDADADADGDC
1379   DTDGDCDCDGDTDGDADCDA
1380   DGDCDADADTDTDCDADTDG
1381   DADADGDCDTDGDGDTDCDG
1382   DCDGDTDCDADADTDGDADA
1383   DGDCDTDADTDGDGDCDTDA
1384   DTDCDCDTDCDGDADCDADA
1385   DGDADTDTDGDADTDADADC
1386   DTDADADGDADGDTDGDGDT
1387   DADTDCDCDTDCDADADGDG
1388   DTDCDGDCDCDADADADGDT
1389   DGDGDTDGDGDCDCDTDTDC
1390   DADTDGDADADTDADCDTDA
1391   DTDTDCDGDADCDTDCDADC
1392   DTDADTDADGDGDADGDADT
1393   DADTDTDADCDCDADTDGDC
1394   DGDTDGDADCDCDCDTDADA
1395   DADGDTDTDADTDCDCDADA
1396   DGDCDADGDADADADTDCDG
1397   DCDTDADADADCDTDGDGDA
1398   DADGDCDTDGDADADCDTDG
1399   DGDADGDGDADCDGDTDTDA
1400   DADGDTDADCDCDADTDGDA
1401   DADGDCDTDADADGDADCDT
1402   DCDGDCDTDCDCDGDCDTDG
1403   DTDTDCDADCDADTDCDTDT
1404   DGDADADGDADADCDTDTDA
1405   DGDGDCDTDGDGDADCDTDT
1406   DGDGDADCDADADGDADCDA
1407   DGDADCDTDGDGDCDTDGDG
1408   DADADGDADADADCDCDADG
1409   DADADGDTDTDADCDCDADA
1410   DGDCDTDGDADGDTDCDADT
1411   DADADGDGDTDGDTDTDCDG
1412   DADTDADADGDGDADCDADC
1413   DTDADTDGDADCDCDCDADC
1414   DADTDCDADADGDGDCDTDG
1415   DGDTDGDADTDTDGDGDGDT
1416   DTDADADGDGDTDTDGDADC
1417   DADTDGDGDGDADGDTDTDG
1418   DTDTDGDGDTDGDGDADTDA
1419   DCDGDGDCDTDADCDGDTDC
1420   DCDGDCDTDCDADGDTDTDA
1421   DGDTDGDGDCDADADADTDA
1422   DTDGDCDADCDADADGDTDG
1423   DTDCDADTDADCDADTDCDA
1424   DCDADGDGDTDGDTDTDADC
1425   DTDCDCDADCDGDCDGDGDT
1426   DGDCDADADTDCDGDTDTDG
1427   DCDCDGDADTDADADGDADC
1428   DCDADADCDADTDGDADTDT
1429   DCDADCDADCDADGDGDTDT
1430   DTDCDTDTDGDADCDADGDT
1431   DTDGDTDTDTDCDADTDADT
1432   DGDADADGDADGDADTDTDG
1433   DTDTDADADGDTDCDADCDG
1434   DADTDADADTDCDADADTDA
1435   DGDGDADGDADADADTDCDA
1436   DADTDADTDGDADTDCDGDT
1437   DTDTDCDTDGDADCDADTDC
1438   DGDADADGDCDTDADADCDG
1439   DCDCDCDTDCDTDTDADGDA
1440   DGDADGDCDGDTDCDADCDT
1441   DADADGDTDTDCDCDADCDT
1442   DGDCDGDGDGDGDTDTDADT
1443   DCDTDADCDGDADCDTDADC
1444   DTDCDCDADCDCDGDCDTDG
1445   DADGDTDADCDGDTDADADG
1446   DCDTDADCDCDGDTDCDCDG
1447   DADGDTDGDADCDTDTDCDG
1448   DGDTDGDCDGDTDADTDCDT
1449   DGDGDADTDGDCDGDCDTDG
1450   DGDADADGDCDCDGDADGDG
1451   DTDTDGDCDADCDGDADGDG
1452   DCDGDGDTDCDTDTDADTDT
1453   DGDTDGDTDTDCDCDADCDA
1454   DADCDGDGDTDCDADCDADA
1455   DGDTDADTDGDADCDGDTDT
1456   DCDCDTDGDCDADTDTDGDA
1457   DCDCDADADADCDTDGDGDC
1458   DADADADGDTDTDGDCDADA
1459   DTDTDGDADADCDCDGDADG
1460   DADGDTDTDCDCDADCDCDT
1461   DTDCDCDTDCDGDTDGDADG
1462   DADADCDTDGDTDADTDTDG
1463   DADCDADCDCDCDTDTDGDT
1464   DGDTDTDGDTDCDADCDGDT
1465   DTDTDGDADTDTDCDADTDT
1466   DCDCDADADCDCDTDCDADA
1467   DGDGDADCDADCDCDGDADT
1468   DADTDGDGDGDTDCDTDTDC
1469   DTDGDCDGDTDTDCDCDGDG
1470   DCDADADGDTDTDGDCDCDC
1471   DGDGDADADADADCDGDCDT
1472   DTDTDGDGDGDTDCDTDCDA
1473   DCDGDCDTDTDTDGDGDADG
1474   DGDCDGDTDGDGDGDGDTDT
1475   DADTDCDGDCDTDTDADGDG
1476   DCDGDADGDADTDGDADADG
1477   DGDGDTDGDADADTDADCDA
1478   DADADGDADCDGDADCDTDT
1479   DTDADADGDCDGDTDADTDG
1480   DCDTDTDGDADADGDADGDC
1481   DADGDGDGDTDGDADADGDA
1482   DADTDADCDGDTDTDGDADC
1483   DGDGDADADTDGDGDADGDT
1484   DGDGDTDGDGDADADCDTDT
1485   DCDADADCDGDADADGDADG
1486   DADTDGDADTDGDGDADCDT
1487   DADTDADADCDGDTDTDCDA
1488   DGDGDADCDGDTDTDGDTDG
1489   DGDTDADADCDTDADADADG
1490   DCDTDCDTDCDCDTDTDGDA
1491   DGDADADGDCDTDADCDTDC
1492   DTDCDTDGDADCDADADADC
1493   DADTDTDADCDTDTDCDCDC
1494   DTDCDCDTDGDADGDADTDT
1495   DGDADCDTDTDTDADCDGDG
1496   DADCDGDTDADGDGDADTDA
1497   DCDADCDTDADCDGDTDTDC
1498   DTDGDGDTDCDADGDADADT
1499   DCDCDCDTDTDGDADGDGDC
1500   DCDGDTDTDGDADCDADTDT
1501   DGDADADCDADTDCDGDTDG
1502   DCDTDGDCDADTDGDGDCDT
1503   DGDCDTDCDGDCDTDADADA
1504   DCDADADGDADGDCDGDCDA
1505   DADCDGDGDGDTDTDCDCDC
1506   DGDTDTDTDGDADCDADCDA
1507   DADADADGDCDADADTDCDG
1508   DADADGDADGDTDTDGDTDA
1509   DCDGDTDADGDADGDTDTDA
1510   DGDCDTDGDCDTDCDGDCDC
1511   DGDCDTDCDTDGDADGDTDT
1512   DGDCDTDCDCDGDTDADADA
1513   DTDTDGDADCDCDGDADADA
1514   DCDGDTDTDCDGDGDCDTDC
1515   DGDTDGDGDTDADTDCDADG
1516   DCDCDTDADADADGDGDTDG
1517   DGDCDADCDTDGDADGDADT
1518   DGDTDTDCDTDGDCDCDADT
1519   DCDCDGDCDGDADADCDADG
1520   DGDTDADADGDCDCDADCDT
1521   DADCDCDTDADADADTDADC
1522   DCDCDTDCDGDCDADTDTDA
1523   DADGDADCDADCDCDTDADA
1524   DADGDTDTDGDGDTDGDGDT
1525   DADTDCDTDTDTDADADGDA
1526   DADGDCDCDTDADADGDADA
1527   DCDADADGDGDCDADCDADG
1528   DCDGDADGDADADGDGDCDC
1529   DGDTDGDADGDCDCDTDTDG
1530   DCDGDADADCDTDTDGDADT
1531   DADCDCDCDGDCDGDADGDT
1532   DADCDGDTDTDGDCDTDGDG
1533   DTDGDCDTDCDCDTDTDADC
1534   DADCDCDCDCDADGDTDTDG
1535   DADADCDADTDGDTDTDGDT
1536   DGDTDTDTDADADCDCDCDT
1537   DTDCDGDTDCDTDCDGDTDG
1538   DADCDCDADCDADTDTDCDA
1539   DGDADADGDADADADCDTDC
1540   DCDADADGDADGDGDCDTDG
1541   DGDGDTDGDGDGDTDCDCDC
1542   DGDADCDCDADADGDTDADC
1543   DADCDCDGDADTDADADGDG
1544   DGDTDGDCDTDCDCDTDGDT
1545   DGDGDTDGDGDADCDGDADT
1546   DGDADGDGDTDADCDTDCDG
1547   DADADGDGDADGDTDADCDG
1548   DTDGDTDADGDADTDGDADC
1549   DCDCDTDGDADGDADADGDC
1550   DADADGDCDCDGDCDTDADT
1551   DCDGDADCDCDTDCDADTDT
1552   DADADADGDADGDTDADCDT
1553   DTDGDADTDGDADTDTDCDA
1554   DGDADADGDCDGDADADTDC
1555   DGDGDADCDADGDTDCDTDG
1556   DCDTDGDADGDGDGDADGDA
1557   DCDADADADGDCDADTDGDG
1558   DCDTDTDCDGDTDTDADTDG
1559   DTDTDGDCDTDGDADGDGDA
1560   DTDGDGDTDADADGDADTDT
1561   DCDADTDGDGDTDTDCDTDG
1562   DTDTDADADCDCDCDTDADA
1563   DTDGDGDADGDCDADGDTDT
1564   DADCDGDGDGDTDCDGDTDG
1565   DCDGDADCDCDCDADTDGDC
1566   DGDTDTDCDCDCDADADADC
1567   DCDTDTDGDCDGDCDADADA
1568   DTDTDCDCDGDGDGDTDGDT
1569   DADCDGDTDTDCDTDCDCDT
1570   DTDADTDGDGDADGDADGDC
1571   DADGDTDGDTDCDGDCDGDC
1572   DTDGDCDTDTDTDTDGDGDC
1573   DGDCDTDGDADGDCDADCDC
1574   DADTDTDTDGDGDADTDGDG
1575   DGDADTDADADCDTDGDGDT
1576   DADADGDCDCDTDTDGDGDG
1577   DTDTDCDADGDGDCDTDGDG
1578   DCDADTDCDGDADCDGDCDA
1579   DTDCDCDGDGDTDCDTDTDG
1580   DADGDCDTDADCDGDCDTDG
1581   DCDTDTDGDGDCDTDCDADC
1582   DTDTDCDADTDGDGDCDTDC
1583   DGDCDTDTDTDGDADTDADA
1584   DCDGDGDCDGDADGDTDADC
1585   DGDCDTDCDADCDGDADGDA
1586   DTDTDCDTDTDADADCDGDG
1587   DCDGDADCDADTDCDCDADC
1588   DADCDTDADADGDADADCDC
1589   DADGDADTDADGDCDTDGDC
1590   DTDGDADADCDTDADCDCDT
1591   DADCDCDCDGDADGDADTDA
1592   DADCDGDCDTDADADGDADC
1593   DGDTDTDCDADTDCDTDADT
1594   DGDGDGDTDTDCDCDTDCDT
1595   DADTDGDGDTDGDCDTDGDG
1596   DTDGDADTDGDADGDADADG
1597   DADTDTDGDGDADCDADGDA
1598   DTDTDGDTDTDGDGDTDGDC
1599   DTDGDGDTDADADADGDADG
1600   DCDGDCDGDGDTDADADGDG
1601   DADADCDTDCDADADGDADA
1602   DGDADADADTDTDCDCDTDT
1603   DGDADGDADADCDADCDCDC
1604   DCDCDGDCDGDADTDTDGDC
1605   DADGDCDADCDTDCDCDGDC
1606   DGDADGDTDCDTDADTDCDC
1607   DADADCDADGDADCDADCDT
1608   DTDGDTDCDGDADGDTDCDC
1609   DTDCDTDCDADADTDGDGDG
1610   DTDADGDCDTDGDGDTDGDA
1611   DGDCDADADCDADADGDTDC
1612   DADADGDTDGDGDADADADC
1613   DGDCDCDGDCDTDGDGDADT
1614   DTDADADADGDGDTDCDTDG
1615   DGDADTDGDGDTDCDGDTDA
1616   DADGDGDTDADCDADCDGDT
1617   DTDCDGDTDADGDTDCDCDT
1618   DCDADCDGDCDTDGDCDCDT
1619   DTDGDADADTDADCDCDCDT
1620   DADCDTDGDCDADADTDCDT
1621   DGDCDTDGDGDTDGDCDTDC
1622   DTDCDADTDCDTDGDCDADA
1623   DADCDTDGDTDGDGDADTDT
1624   DADTDCDADADGDADCDCDG
1625   DADADGDADGDADTDGDCDT
1626   DCDGDTDADGDADGDADADA
1627   DGDGDCDTDTDGDADADGDC
1628   DADTDGDGDCDTDGDGDGDA
1629   DTDGDGDGDGDADCDTDTDT
1630   DGDCDGDTDADCDADTDGDG
1631   DCDADTDGDGDGDTDADCDA
1632   DTDGDADTDGDADADADTDC
1633   DCDADADGDTDADGDGDCDT
1634   DGDCDCDGDTDADCDCDGDA
1635   DADGDADGDADTDTDGDCDT
1636   DCDADGDGDTDGDGDTDCDA
1637   DTDTDGDADGDADCDCDGDC
1638   DADCDADADGDADADGDCDG
1639   DADTDGDCDGDCDTDGDGDG
1640   DTDTDGDGDADGDADCDCDA
1641   DCDTDGDGDADADCDTDTDC
1642   DCDGDGDTDGDTDCDTDTDC
1643   DTDGDGDADTDADCDCDGDA
1644   DADGDGDTDADADGDADTDG
1645   DGDGDTDCDCDTDADADTDT
1646   DGDGDGDCDGDADTDTDTDG
1647   DCDCDADCDTDGDADTDADC
1648   DADGDGDADGDGDCDTDADC
1649   DTDCDADTDGDADADCDGDA
1650   DADADGDADCDADCDTDTDA
1651   DADCDADGDGDTDGDCDTDG
1652   DCDTDTDCDTDGDADADADT
1653   DGDCDTDADGDTDADGDCDC
1654   DTDADCDADADADTDTDTDA
1655   DCDCDADADADGDCDTDGDG
1656   DGDTDADCDADCDTDGDTDC
1657   DTDADTDTDADCDCDCDTDA
1658   DTDGDCDTDGDADCDTDCDA
1659   DGDADGDTDADADADGDADG
1660   DGDADCDTDTDGDGDTDTDG
1661   DTDADTDGDTDADADGDGDA
1662   DTDGDGDTDADADADTDTDT
1663   DADGDTDADADGDGDTDTDC
1664   DADGDGDTDTDADADADADC
1665   DADGDCDCDADCDADADCDG
1666   DGDTDTDCDADADADCDCDA
1667   DADCDADCDADGDGDADGDA
1668   DTDGDCDCDADADGDCDADG
1669   DGDTDTDADGDGDCDTDADG
1670   DGDTDGDGDADTDGDCDGDG
1671   DTDADGDGDTDCDCDGDADA
1672   DTDADTDADADGDGDADTDG
1673   DGDADGDADCDTDTDTDGDA
1674   DCDADTDTDCDTDTDGDCDG
1675   DGDTDTDGDTDGDGDTDTDG
1676   DADCDGDADADGDADTDGDT
1677   DGDCDTDTDADTDTDTDTDC
1678   DADCDADTDGDGDGDADCDG
1679   DADADGDTDADADADADGDG
1680   DTDADADGDADCDADTDCDC
1681   DADTDGDTDGDTDGDTDCDG
1682   DGDCDADADGDADGDADADA
1683   DCDADADADGDGDCDADTDA
1684   DADADADCDTDADTDADGDG
1685   DADGDADADADTDTDADTDT
1686   DADTDGDGDCDTDADTDGDA
1687   DCDADADADGDADADADTDT
1688   DTDADADADGDTDGDTDCDC
1689   DTDTDCDGDADCDGDTDTDA
1690   DCDCDGDCDADADADGDADT
1691   DGDTDCDGDTDCDTDGDADC
1692   DGDTDTDCDADGDGDCDADA
1693   DTDCDTDTDADGDADGDADA
1694   DADGDADTDADTDGDCDTDG
1695   DCDADTDCDTDADTDGDTDA
1696   DADGDCDADGDGDTDCDGDG
1697   DCDTDCDADGDGDTDGDCDG
1698   DADTDTDGDTDCDCDCDCDA
1699   DADTDGDGDTDADADADCDA
1700   DGDADADGDGDADADADTDG
1701   DADTDTDGDTDCDCDADGDT
1702   DTDCDCDTDGDADCDADCDA
1703   DCDGDGDTDADTDGDGDADA
1704   DGDGDADTDTDGDADTDGDA
1705   DCDADTDTDCDGDTDADGDT
1706   DADCDGDTDADCDADTDCDA
1707   DTDTDTDCDGDTDGDADGDG
1708   DCDCDADTDTDADADGDGDA
1709   DCDADTDGDCDADCDGDADA
1710   DGDADGDTDADTDGDCDADG
1711   DADTDADADGDGDADCDTDC
1712   DTDTDTDCDADADADCDADA
1713   DTDCDTDCDCDTDGDCDADA
1714   DCDADGDTDADCDGDGDGDA
1715   DGDGDTDGDTDTDCDTDGDA
1716   DTDGDTDCDTDGDADCDTDA
1717   DCDCDTDGDADADADGDTDG
1718   DCDTDGDCDADADGDCDADA
1719   DTDCDADADADADGDTDTDG
1720   DCDCDCDTDADADGDADCDT
1721   DTDTDCDCDADGDTDCDCDA
1722   DADCDTDADTDGDTDADCDG
1723   DGDADADCDADADTDGDCDG
1724   DADGDCDCDTDCDGDTDADG
1725   DCDGDGDADGDGDCDCDGDC
1726   DTDTDCDCDCDGDTDGDGDT
1727   DCDADCDADTDCDTDCDGDT
1728   DGDCDCDTDGDADCDTDADC
1729   DTDADGDTDGDGDADCDGDT
1730   DADADCDGDGDTDGDGDCDG
1731   DCDTDTDGDGDGDADADADT
1732   DCDADCDTDGDCDTDTDCDC
1733   DGDGDTDADCDTDCDGDCDT
1734   DTDTDCDTDGDADADADCDG
1735   DADADTDGDGDGDADGDGDA
1736   DTDGDTDGDTDCDTDADADT
1737   DGDTDCDTDCDGDTDGDADC
1738   DCDTDTDGDTDGDADCDTDA
1739   DTDTDCDCDADCDGDCDGDA
1740   DTDGDTDGDTDGDGDADADC
1741   DGDADTDADTDADCDADGDG
1742   DGDCDTDADCDADTDCDGDA
1743   DCDTDCDTDCDTDGDGDADA
1744   DCDGDTDGDADGDADADCDG
1745   DADTDADGDCDCDTDTDADA
1746   DGDADADTDCDADADCDTDA
1747   DADTDGDGDADADGDCDTDG
1748   DADCDGDADADTDADCDGDT
1749   DADGDCDGDGDADADCDTDA
1750   DGDADGDGDADGDADADADC
1751   DTDTDADADTDGDGDCDADC
1752   DTDTDCDTDTDGDADCDCDT
1753   DTDADADADCDADADTDTDC
1754   DTDADTDGDADGDTDTDADC
1755   DGDTDGDADADGDGDCDTDG
1756   DCDGDADCDGDADCDADADG
1757   DGDGDTDADTDCDCDTDTDG
1758   DTDGDADTDGDGDADCDGDG
1759   DCDGDADCDTDGDGDCDTDG
1760   DGDTDCDTDTDCDCDADADG
1761   DCDTDADTDGDADGDTDGDC
1762   DTDGDCDTDGDADGDTDTDT
1763   DGDADTDGDCDCDTDCDTDT
1764   DGDGDGDADGDGDADADGDA
1765   DGDADTDTDTDGDGDCDADC
1766   DCDGDADTDGDCDTDGDTDG
1767   DADCDCDADCDGDCDTDADA
1768   DGDGDCDCDCDGDTDCDADG
1769   DADTDTDCDTDTDGDADGDG
1770   DADTDTDCDCDADTDTDADA
1771   DGDTDCDCDTDADCDGDADG
1772   DADCDCDCDGDTDADADGDA
1773   DADGDGDCDTDTDGDGDGDC
1774   DADGDGDTDGDCDTDCDCDA
1775   DADTDTDGDTDCDCDTDTDG
1776   DCDGDTDTDCDADCDCDGDA
1777   DTDADGDTDGDTDTDADADC
1778   DTDGDGDCDGDTDADADADG
1779   DADADCDTDGDGDTDTDGDA
1780   DCDCDCDGDADADCDTDADT
1781   DADADGDGDCDTDADADCDC
1782   DGDTDADADGDGDCDCDGDT
1783   DGDADADGDADADADCDCDT
1784   DGDTDADGDGDGDTDADCDT
1785   DTDTDGDADGDTDTDCDCDT
1786   DTDGDADTDGDCDTDCDTDC
1787   DTDTDTDGDADGDCDGDCDG
1788   DADADGDADGDTDTDCDTDA
1789   DTDTDGDCDADTDCDCDGDT
1790   DGDADGDCDCDTDADTDGDC
1791   DTDTDGDADGDGDGDTDGDA
1792   DTDGDADCDGDTDTDADTDG
1793   DGDGDADGDTDTDADTDTDG
1794   DCDTDTDCDCDADADTDCDC
1795   DGDTDCDTDGDCDCDTDTDC
1796   DGDGDTDGDCDTDCDGDTDA
1797   DADGDGDCDTDGDTDADADT
1798   DCDADTDCDTDCDTDTDGDC
1799   DGDADTDADADGDGDADCDT
1800   DTDTDADADGDADCDCDADT
1801   DCDCDCDTDADADCDTDGDT
1802   DGDADCDTDTDCDCDTDGDT
1803   DGDGDTDGDTDADCDCDADC
1804   DTDGDGDTDADADCDADTDC
1805   DCDTDGDADCDTDCDADGDA
1806   DCDCDGDADADGDADGDTDC
1807   DCDGDCDTDGDADCDTDGDG
1808   DTDGDGDCDADCDCDTDCDT
1809   DTDCDCDADGDADCDCDADT
1810   DCDADADGDGDGDTDGDADC
1811   DADTDCDADCDTDGDADTDG
1812   DGDTDTDADCDTDCDADGDG
1813   DGDADTDTDGDCDTDGDGDA
1814   DTDGDGDGDGDTDGDADTDA
1815   DCDCDGDCDCDGDADGDGDA
1816   DCDTDTDCDTDTDGDADADT
1817   DADADCDCDCDGDTDTDCDA
1818   DTDADADCDCDGDADGDCDC
1819   DTDADADADADCDGDTDCDT
1820   DGDTDGDCDTDTDADADGDT
1821   DCDCDGDGDTDADADGDADA
1822   DCDADADADGDGDCDCDADA
1823   DGDADGDGDTDTDADCDTDA
1824   DADADTDGDGDGDTDTDADA
1825   DADCDGDCDGDADCDCDCDT
1826   DGDADGDCDCDTDCDADTDG
1827   DADGDADCDGDCDTDTDTDG
1828   DGDGDADCDTDGDCDADTDT
1829   DADADGDTDCDCDADTDTDG
1830   DGDCDGDCDGDADADGDGDC
1831   DTDGDGDTDADTDGDADCDC
1832   DGDADADGDADGDGDADTDA
1833   DTDTDADTDCDADADGDCDA
1834   DGDGDGDCDCDADADADTDG
1835   DGDCDTDCDGDADADTDCDC
1836   DTDADCDGDGDTDTDCDADA
1837   DCDGDADGDTDADCDADADC
1838   DTDTDTDADTDTDGDADCDA
1839   DADGDGDADGDADTDTDTDA
1840   DCDCDTDGDTDGDGDADGDA
1841   DCDCDGDTDADGDCDGDTDA
1842   DTDADTDTDGDGDTDCDTDG
1843   DGDGDTDCDTDTDTDGDTDG
1844   DTDTDCDTDCDGDGDADGDT
1845   DGDTDGDCDCDTDCDADTDT
1846   DTDCDGDTDGDGDGDGDCDC
1847   DTDTDTDGDGDGDADCDTDT
1848   DADGDCDCDADGDADADTDA
1849   DADTDCDADADGDTDCDGDT
1850   DTDADCDADCDGDADCDADC
1851   DTDADADGDTDGDADTDADA
1852   DADCDTDCDADADGDGDTDC
1853   DCDCDTDADADADTDTDADA
1854   DTDADCDGDADCDTDCDADC
1855   DTDADTDADGDGDGDADGDA
1856   DTDADGDGDGDGDCDCDTDT
1857   DTDADCDGDADTDTDADTDT
1858   DADCDTDTDTDADADGDADT
1859   DTDTDADADCDTDCDTDADA
1860   DGDADGDGDADADTDCDTDT
1861   DTDADTDTDADTDGDTDTDA
1862   DADCDADCDCDTDADTDTDA
1863   DADCDCDADADTDTDADCDT
1864   DTDADADGDADADCDCDCDT
1865   DADADCDGDADTDADTDTDC
1866   DCDADGDADTDGDTDADCDC
1867   DTDCDGDTDGDCDADADCDC
1868   DGDCDTDGDADGDTDADTDC
1869   DTDADCDADGDGDTDTDCDG
1870   DADTDTDCDADADCDTDADT
1871   DGDCDGDTDADCDCDTDCDG
1872   DADADGDCDGDTDCDTDGDG
1873   DTDCDADTDADTDADGDGDA
1874   DCDTDTDADTDGDCDGDTDG
1875   DCDTDADADTDGDGDTDTDG
1876   DTDADGDTDGDADGDGDCDC
1877   DCDADCDADTDCDTDTDGDG
1878   DGDTDTDTDCDADTDTDCDA
1879   DGDGDGDCDCDTDADCDADG
1880   DTDADTDGDCDCDTDCDTDA
1881   DADCDGDTDCDADTDTDGDA
1882   DCDGDADGDADTDTDGDADG
1883   DTDTDADCDGDCDADADGDG
1884   DADADCDADADCDTDADADG
1885   DADGDADTDGDADTDGDGDG
1886   DGDADGDGDADTDTDGDADC
1887   DADCDTDADTDGDTDGDTDT
1888   DTDCDTDCDADCDCDGDADA
1889   DADADTDTDADADADADCDT
1890   DCDCDGDADADGDADTDGDG
1891   DADTDADCDCDADADTDCDA
1892   DGDADTDTDCDGDADGDCDC
1893   DGDTDTDGDADGDCDCDADG
1894   DCDGDCDCDTDCDTDGDADC
1895   DCDCDADADGDADADGDTDG
1896   DTDCDADADGDCDGDTDGDG
1897   DADGDTDTDCDGDGDTDGDG
1898   DGDTDCDTDTDCDTDGDADT
1899   DGDADGDADCDGDGDADTDA
1900   DCDCDGDADGDGDGDCDADC
1901   DCDGDADADGDTDGDTDCDT
1902   DGDGDADCDGDCDADADADG
1903   DGDCDCDTDCDADADGDGDT
1904   DCDGDADADCDGDTDGDADT
1905   DGDADTDTDCDCDGDTDADG
1906   DCDGDADADGDTDCDTDADA
1907   DADGDCDCDADGDCDGDGDC
1908   DADADTDGDGDCDTDCDCDG
1909   DCDTDCDGDTDADTDGDADA
1910   DADTDCDTDTDCDCDADTDC
1911   DCDGDTDADADGDTDCDCDG
1912   DCDADTDTDTDGDGDADGDG
1913   DTDADADGDADADGDTDGDA
1914   DTDGDTDCDTDGDADGDTDT
1915   DCDADCDADTDGDTDGDTDG
1916   DGDADGDGDCDTDADADGDA
1917   DGDTDCDGDCDTDTDCDCDG
1918   DTDGDCDADADTDCDCDGDG
1919   DTDGDGDADCDTDGDTDGDG
1920   DADADCDADCDCDTDTDGDG
1921   DGDTDTDGDCDCDTDADADA
1922   DGDGDADTDTDCDGDADADG
1923   DGDADCDADCDTDTDTDGDT
1924   DGDGDGDCDTDADCDADGDC
1925   DCDTDCDTDADCDGDTDADG
1926   DADCDGDADADGDTDGDADT
1927   DGDGDADCDADTDGDTDCDT
1928   DGDGDTDTDGDCDCDGDTDG
1929   DADADGDADGDTDADCDADT
1930   DTDCDTDGDGDADCDTDCDT
1931   DADCDCDGDGDADADADADC
1932   DADTDGDTDADGDCDGDTDA
1933   DCDTDTDCDGDCDGDTDGDG
1934   DTDGDCDGDTDADADGDCDT
1935   DGDTDGDADCDADTDTDCDA
1936   DCDCDADCDADADADGDGDA
1937   DGDADCDADTDTDCDTDGDG
1938   DADTDGDTDADADCDGDTDC
1939   DCDGDTDTDGDTDCDADTDT
1940   DADADTDCDCDTDGDADGDG
1941   DCDADGDADCDTDCDTDADA
1942   DGDGDGDCDTDTDADCDADG
1943   DCDGDADTDTDCDCDTDADG
1944   DCDGDADADADCDGDCDTDT
1945   DTDADADGDTDADCDCDTDT
1946   DGDCDGDGDADADCDTDCDC
1947   DADCDGDADTDTDGDCDGDA
1948   DTDTDGDGDGDTDGDTDCDT
1949   DCDGDTDTDGDTDADADGDC
1950   DADTDGDADADGDGDCDGDA
1951   DGDADCDADADTDGDCDGDT
1952   DGDTDADTDADCDTDTDTDA
1953   DADGDGDADGDGDTDADTDA
1954   DADGDTDTDADTDGDGDGDT
1955   DADADGDADADADGDTDTDA
1956   DADGDADADGDGDCDCDGDT
1957   DGDADADGDADADADGDTDC
1958   DADCDCDADADGDTDCDCDG
1959   DTDTDADADGDADADADGDT
1960   DCDGDTDTDADADGDGDADA
1961   DGDGDGDGDCDTDCDGDTDC
1962   DCDGDGDTDTDADADADCDA
1963   DGDGDTDTDGDCDTDGDGDC
1964   DGDGDTDCDTDADGDCDTDG
1965   DGDTDCDTDGDGDCDTDGDG
1966   DTDGDGDTDADCDTDGDGDT
1967   DGDADADGDCDADCDADGDA
1968   DTDGDGDTDGDGDADADGDT
1969   DADCDCDADCDADADGDCDT
1970   DGDCDCDGDCDADCDADGDA
1971   DTDTDGDTDTDGDADCDGDT
1972   DADCDCDTDGDADGDADADA
1973   DGDADGDGDTDTDTDCDCDA
1974   DCDTDGDADGDGDADCDGDA
1975   DADGDCDADCDADGDADCDA
1976   DGDADADADGDCDGDGDADC
1977   DGDCDADADGDADADADGDC
1978   DTDCDGDTDGDCDTDGDGDC
1979   DGDGDTDADADGDADADADT
1980   DCDCDTDTDGDADGDTDGDT
1981   DADGDCDCDCDGDTDADGDC
1982   DTDCDCDGDGDTDGDGDCDG
1983   DGDTDADTDCDADADCDADT
1984   DTDTDADADTDCDADGDGDA
1985   DGDGDTDTDADTDCDGDTDG
1986   DGDADADGDADCDTDGDCDA
1987   DTDTDGDADADTDGDGDADC
1988   DCDGDGDADGDGDTDGDTDC
1989   DADADCDTDCDTDADADGDG
1990   DGDTDTDADTDGDGDTDCDG
1991   DTDADADGDTDGDGDGDTDT
1992   DADADTDGDGDTDADADADC
1993   DTDTDGDTDGDADCDTDCDC
1994   DADCDADTDADGDGDCDADC
1995   DADTDCDTDADTDGDADGDG
1996   DADGDADCDADTDADTDGDG
1997   DTDCDCDADGDTDTDCDCDA
1998   DADCDADGDGDADADTDTDG
1999   DTDGDGDTDGDADTDGDCDA
2000   DTDADTDCDTDGDCDGDADT
2001   DADADCDCDCDTDADGDGDT
2002   DGDCDTDADTDADADCDADT
2003   DADADADGDCDADCDCDTDT
2004   DADCDGDCDTDTDGDGDADA
2005   DCDTDCDCDADADADGDGDA
2006   DTDADADTDTDCDCDGDADG
2007   DGDADCDADTDGDGDTDTDA
2008   DCDCDADADADGDGDTDADG
2009   DADCDADGDGDCDTDADADA
2010   DGDGDADGDADGDGDADADC
2011   DTDADADGDCDADADGDADA
2012   DADCDTDTDADCDADGDADG
2013   DTDCDADGDADCDGDTDTDC
2014   DTDCDGDCDTDADTDADCDG
2015   DCDTDCDTDTDCDADADCDC
2016   DTDTDADADGDCDCDADCDC
2017   DGDCDTDCDCDTDTDADGDG
2018   DADGDADADCDTDGDTDADT
2019   DGDGDADGDTDCDADGDTDC
2020   DADADTDCDADADCDCDADT
2021   DADADCDGDCDGDADADTDA
2022   DCDTDADCDADGDCDGDTDA
2023   DADGDADCDADTDGDGDADG
2024   DADCDADCDADTDTDTDADA
2025   DTDGDGDCDTDGDADGDADA
2026   DADCDGDADADCDADGDGDA
2027   DCDTDTDGDCDGDGDADGDG
2028   DADTDGDGDCDGDCDADADA
2029   DGDTDCDTDGDTDCDTDADT
2030   DGDADGDCDGDTDTDTDADA
2031   DADGDADADCDGDADCDCDG
2032   DTDGDCDTDCDCDCDTDADT
2033   DGDADGDADCDADCDGDCDG
2034   DCDTDCDADGDADADTDTDG
2035   DCDGDCDTDCDADADTDADT
2036   DADCDCDADTDCDCDCDADT
2037   DCDADTDTDGDTDTDCDCDC
2038   DTDADADGDGDADCDTDCDC
2039   DGDADTDADADCDGDCDCDT
2040   DCDTDADCDADGDADTDTDA
2041   DTDCDADADADCDTDCDCDG
2042   DTDGDGDCDADADGDCDCDG
2043   DTDGDGDGDCDGDCDTDCDG
2044   DTDGDGDTDCDTDGDADADC
2045   DADADTDCDTDADGDCDCDT
2046   DCDTDADADGDCDTDCDADT
2047   DGDCDTDGDGDCDTDCDTDA
2048   DTDTDCDCDCDTDADTDGDC
2049   DADGDADCDTDTDGDGDADT
2050   DGDCDGDADCDTDTDADCDT
2051   DADTDADTDCDTDGDADADT
2052   DADTDGDADADGDCDADADA
2053   DGDCDADGDTDTDADCDTDG
2054   DADGDCDGDADCDCDCDCDG
2055   DADTDGDGDADCDTDCDGDC
2056   DTDADADGDGDTDCDGDADT
2057   DGDADGDGDGDCDCDTDCDT
2058   DCDGDADTDGDGDTDADGDA
2059   DGDCDGDTDADTDCDADTDC
2060   DADTDGDADADCDTDADCDA
2061   DTDTDGDADGDTDCDTDADA
2062   DCDADGDTDTDADCDCDGDC
2063   DGDTDGDADCDTDCDTDCDT
2064   DTDTDGDADGDGDCDTDCDT
2065   DCDADADADCDADGDTDTDA
2066   DGDTDCDGDTDADGDCDTDG
2067   DGDTDADADCDGDTDCDCDT
2068   DGDCDTDGDTDADCDCDTDA
2069   DCDCDGDGDADADCDCDGDG
2070   DADADGDGDGDTDCDADADA
2071   DCDTDADTDADADTDCDCDC
2072   DADTDGDADADGDCDTDGDT
2073   DADCDCDGDADTDTDGDTDC
2074   DTDTDCDTDTDADTDGDTDG
2075   DGDTDCDCDADADCDGDADG
2076   DADCDGDCDADTDTDCDGDG
2077   DCDADADCDGDTDTDCDTDG
2078   DCDADADADTDGDGDTDGDA
2079   DCDTDCDGDTDGDADCDCDA
2080   DGDADTDADGDCDTDTDTDT
2081   DGDGDTDGDCDTDCDTDCDC
2082   DCDTDGDADGDGDADCDADT
2083   DCDCDGDTDADADGDGDCDT
2084   DGDTDADGDADADGDGDTDC
2085   DADADGDGDTDGDGDTDGDA
2086   DGDADADGDADADADGDCDT
2087   DGDADTDGDADGDADCDADA
2088   DTDCDGDADCDGDTDGDTDA
2089   DCDADCDTDCDADCDADTDC
2090   DTDADTDCDTDGDGDADTDG
2091   DADGDGDADCDTDCDADGDG
2092   DTDGDADADTDADCDCDTDC
2093   DCDGDADTDADCDGDADADG
2094   DADGDGDTDCDGDADGDGDG
2095   DTDADTDGDGDADADGDTDC
2096   DCDADADGDGDCDTDCDCDG
2097   DADTDGDGDGDADCDTDTDA
2098   DTDCDCDTDADADADGDADG
2099   DGDCDTDTDGDCDCDCDADT
2100   DADCDADTDCDCDCDGDADT
2101   DTDCDGDGDADTDGDGDTDC
2102   DADGDADCDTDADGDADTDG
2103   DGDTDGDADADTDCDCDTDA
2104   DCDGDGDTDCDGDTDTDCDG
2105   DTDADCDADTDTDGDADGDG
2106   DADADTDADCDTDTDADGDG
2107   DTDGDADCDTDTDADCDGDG
2108   DTDCDCDCDTDTDGDADADA
2109   DADTDCDTDCDCDADADGDA
2110   DGDGDCDTDADTDCDGDTDC
2111   DADADGDADTDGDTDCDCDA
2112   DTDGDADTDTDADGDCDTDC
2113   DTDADADGDGDTDTDADTDC
2114   DGDGDCDTDTDADGDTDGDA
2115   DADTDCDCDTDGDCDTDGDG
2116   DTDADTDCDADCDCDCDADG
2117   DCDCDADCDGDCDCDGDADC
2118   DTDGDADCDCDADADADGDC
2119   DTDCDADGDADCDTDGDGDT
2120   DGDADCDTDTDCDGDTDTDA
2121   DCDTDGDGDTDCDGDTDCDC
2122   DADGDADADGDADCDADTDC
2123   DTDCDGDTDTDCDCDTDCDC
2124   DADADCDTDGDGDADGDADA
2125   DGDCDADADGDCDADGDADC
2126   DTDTDTDADCDTDGDTDADG
2127   DCDTDADADADGDCDCDGDT
2128   DADADGDTDGDADCDGDCDT
2129   DADTDCDGDADGDGDCDTDC
2130   DGDCDCDTDTDTDCDGDTDT
2131   DTDGDCDCDTDTDTDADTDG
2132   DTDTDGDADADCDTDCDTDG
2133   DCDGDGDTDTDCDADGDCDG
2134   DTDADCDADGDGDTDGDADA
2135   DCDGDTDGDTDGDADCDCDG
2136   DCDCDGDADADGDADGDADT
2137   DTDCDGDGDTDADTDGDTDA
2138   DGDCDTDTDCDTDGDADADC
2139   DTDTDGDADADGDADTDADC
2140   DTDTDTDADGDGDTDGDGDT
2141   DGDTDCDTDADCDTDCDTDA
2142   DTDCDCDTDTDTDCDTDCDA
2143   DADGDADADTDTDADCDADA
2144   DTDTDGDCDCDTDCDTDGDG
2145   DTDADCDGDADGDTDGDCDT
2146   DCDTDTDGDADADGDCDADA
2147   DCDTDADCDADADGDCDCDA
2148   DCDGDCDADADCDADGDADT
2149   DTDCDCDTDGDADGDTDTDA
2150   DCDCDTDADADGDGDADADG
2151   DCDCDGDTDADGDADGDCDC
2152   DADADCDCDADTDTDADGDT
2153   DADCDADGDGDTDCDTDGDG
2154   DADADGDCDADADTDTDGDG
2155   DTDCDGDADGDGDADCDADA
2156   DGDADCDCDTDTDGDADTDA
2157   DADGDCDTDGDGDADGDCDG
2158   DGDTDGDTDGDTDCDADCDT
2159   DGDCDGDTDGDGDGDCDTDG
2160   DCDADCDTDGDGDCDADCDC
2161   DTDADTDGDCDGDGDGDADC
2162   DGDADCDCDCDTDGDADTDA
2163   DTDTDADADCDCDTDTDGDC
2164   DGDADTDGDADTDTDADADG
2165   DTDTDADCDGDTDADTDTDG
2166   DCDCDADADCDGDCDTDADT
2167   DCDGDGDTDADTDTDGDADC
2168   DADCDTDTDCDTDGDGDTDA
2169   DTDTDCDTDADCDTDCDADC
2170   DCDGDADADGDADADCDADG
2171   DADADGDCDADADCDADGDA
2172   DADGDADTDGDGDCDCDCDA
2173   DADCDADGDTDCDTDADTDG
2174   DCDADADADTDGDGDGDTDA
2175   DTDGDGDADTDADADTDGDG
2176   DTDGDCDTDGDCDTDGDCDG
2177   DCDTDGDGDCDTDCDADADG
2178   DGDTDADTDGDGDCDTDGDC
2179   DADCDADADGDCDTDADCDA
2180   DGDCDTDTDCDADCDCDTDG
2181   DADGDGDCDTDADTDGDGDC
2182   DTDGDCDTDGDCDCDGDCDT
2183   DGDADTDTDCDCDGDTDADG
2184   DGDTDTDTDADCDADGDCDC
2185   DGDGDGDADADTDTDTDADA
2186   DTDADCDGDADCDTDCDADC
2187   DTDADTDADGDGDGDADGDA
2188   DCDCDTDCDADTDCDTDTDT
2189   DGDADADADTDGDADGDCDG
2190   DADTDGDADCDADADGDADG
2191   DGDTDTDGDGDADGDTDCDC
2192   DTDCDGDGDTDCDTDTDCDC
2193   DTDGDTDADGDTDTDCDADA
2194   DCDTDTDTDADADGDGDADG
2195   DADCDADADTDADADTDADA
2196   DTDGDGDCDTDGDADADTDC
2197   DTDADADTDGDCDADGDADC
2198   DGDTDADTDADTDGDCDADT
2199   DCDTDTDTDTDGDGDCDGDT
2200   DGDADADCDTDCDCDGDCDT
2201   DGDTDGDADTDGDTDCDTDG
2202   DGDTDGDGDTDTDCDCDGDT
2203   DTDGDADGDGDADADCDADT
2204   DGDADGDCDADGDADADCDA
2205   DTDGDCDTDGDGDCDTDCDT
2206   DTDGDADTDGDTDTDGDCDT
2207   DGDCDCDCDGDTDGDADTDG
2208   DGDCDGDADTDGDADTDGDC
2209   DADADTDCDGDADGDTDTDA
2210   DGDCDGDTDCDADGDADCDG
2211   DADADGDTDGDGDADADADC
2212   DADGDADADCDGDTDGDADC
2213   DCDTDGDTDADTDGDADCDA
2214   DADCDTDCDTDGDADCDCDC
2215   DGDTDTDCDGDGDTDCDADA
2216   DGDADGDGDADTDGDADCDG
2217   DADADGDGDCDCDGDCDADT
2218   DTDCDADGDGDTDTDCDGDT
2219   DADTDCDGDGDTDGDADTDG
2220   DGDCDTDCDTDGDADGDCDC
2221   DGDADCDCDGDADTDGDTDG
2222   DGDADCDADCDTDGDGDADG
2223   DADADGDADADGDGDCDGDT
2224   DTDGDADGDGDGDCDADCDC
2225   DGDADADGDGDTDTDCDCDG
2226   DADADGDADGDTDTDTDADC
2227   DCDCDCDADCDTDGDGDGDC
2228   DGDADGDADCDTDCDCDADG
2229   DADADGDADADCDTDGDGDT
2230   DADGDCDTDGDCDCDTDCDT
2231   DGDADGDCDADADCDTDTDG
2232   DGDTDGDADGDCDADCDGDA
2233   DADGDADGDGDGDCDTDTDC
2234   DCDADADGDADGDADTDGDA
2235   DTDTDADADCDADTDTDGDC
2236   DTDGDCDTDGDADGDCDGDT
2237   DGDGDCDADTDGDADGDTDG
2238   DTDCDGDADGDADCDCDADT
2239   DTDGDADGDGDCDTDADTDC
2240   DCDADGDCDGDTDGDADGDT
2241   DADCDGDADGDGDADGDADA
2242   DCDGDADADGDADGDTDTDG
2243   DTDCDCDGDCDCDGDADGDT
2244   DCDCDTDADCDGDCDTDADA
2245   DGDCDTDGDGDCDTDGDADA
2246   DADTDTDGDGDCDTDADCDA
2247   DCDGDADADGDGDCDTDTDT
2248   DCDADTDTDGDADCDTDCDG
2249   DTDADTDADTDCDCDGDTDG
2250   DGDTDCDADADGDADADGDC
2251   DTDCDTDGDGDTDGDGDADG
2252   DCDADGDTDADCDGDTDADA
2253   DADCDADGDTDGDTDCDADT
2254   DTDGDADGDTDADCDGDCDT
2255   DGDGDTDGDGDTDCDGDTDG
2256   DADADCDGDTDTDTDTDGDA
2257   DTDGDCDADCDTDGDTDADT
2258   DADADCDCDADCDCDTDTDG
2259   DADGDADCDGDCDADCDADA
2260   DCDCDCDTDGDADGDGDCDT
2261   DGDCDADCDADGDTDCDGDC
2262   DTDGDGDADTDADADTDGDC
2263   DGDTDTDGDADCDCDADADT
2264   DCDGDTDGDADCDTDTDADG
2265   DCDGDADCDCDGDTDTDADA
2266   DGDGDCDTDADTDCDADTDC
2267   DADADCDTDTDGDGDCDTDG
2268   DGDTDGDADGDTDCDTDCDG
2269   DCDGDCDTDADADGDGDCDG
2270   DTDTDCDGDGDTDCDGDTDA
2271   DADGDCDCDADADCDTDCDG
2272   DTDADGDTDGDTDGDADCDT
2273   DADADTDCDGDTDGDCDTDA
2274   DTDTDCDCDGDGDCDTDADA
2275   DADCDCDTDCDADGDGDCDT
2276   DADCDCDADADGDCDGDTDG
2277   DADADGDGDCDTDTDTDGDC
2278   DGDGDADCDCDGDTDADGDC
2279   DGDADGDADTDGDADTDTDA
2280   DADADGDCDTDADTDGDADG
2281   DTDGDADCDCDCDTDCDGDG
2282   DTDADTDCDGDCDADCDADG
2283   DADTDGDCDCDADADCDTDA
2284   DTDCDGDTDCDGDTDCDADA
2285   DGDTDCDGDADADCDADGDA
2286   DADADGDTDADADTDCDGDA
2287   DTDTDCDGDADADCDTDTDC
2288   DTDGDADTDADGDADCDTDT
2289   DCDGDADADADTDTDADADT
2290   DADCDGDADCDTDCDADCDT
2291   DADTDADGDGDGDADGDADC
2292   DCDADCDADADCDGDGDTDT
2293   DTDCDCDCDTDCDTDADGDA
2294   DADADTDADADTDTDTDTDG
2295   DTDTDTDADADCDTDTDTDA
2296   DADGDADADGDGDADGDADT
2297   DADTDADCDADTDADTDGDG
2298   DCDTDADGDCDADTDGDADC
2299   DTDGDGDTDGDGDADCDADG
2300   DCDADADADTDGDGDGDTDA
2301   DCDTDADADCDCDADADGDG
2302   DTDADADADGDGDTDGDTDA
2303   DGDTDTDGDCDTDGDCDTDG
2304   DGDADGDADTDADADADCDT
2305   DGDGDCDGDTDTDGDTDTDC
2306   DTDTDGDADADGDGDTDADT
2307   DTDTDGDGDCDGDGDTDGDA
2308   DADGDTDCDCDTDGDADCDT
2309   DGDCDGDTDTDCDGDCDTDC
2310   DGDTDADCDCDTDCDCDGDT
2311   DGDADCDCDADCDTDTDCDT
2312   DCDGDCDCDADCDADTDGDG
2313   DTDADCDGDTDTDCDCDADT
2314   DCDTDCDCDADGDCDGDGDT
2315   DADADADTDCDCDGDCDTDC
2316   DADGDTDTDCDCDCDTDGDT
2317   DTDCDTDGDGDGDTDCDGDC
2318   DADCDTDCDADGDGDCDADG
2319   DCDGDTDADTDCDTDGDGDC
2320   DTDCDCDGDGDGDCDGDADG
2321   DADADCDCDTDCDGDADCDG
2322   DADTDADADADCDGDTDADA
2323   DGDGDADCDADTDCDADADA
2324   DCDADCDADCDCDGDADGDA
2325   DADGDGDTDADADTDCDADC
2326   DCDADTDTDGDADCDGDGDT
2327   DCDTDCDCDTDGDADCDGDG
2328   DCDTDGDADCDGDTDTDCDT
2329   DGDADTDTDTDADTDGDADT
2330   DADTDTDGDADGDGDADCDG
2331   DCDGDADTDGDADADCDCDA
2332   DCDTDADCDGDADCDGDTDT
2333   DCDGDCDTDCDTDGDADGDT
2334   DADTDADCDCDTDCDTDCDA
2335   DGDTDTDGDGDGDTDGDADA
2336   DTDCDTDCDTDGDGDCDGDA
2337   DTDGDGDCDTDGDCDGDGDA
2338   DTDGDGDTDGDCDGDGDTDT
2339   DCDTDGDGDCDTDGDADGDA
2340   DTDTDGDCDCDGDGDTDCDT
2341   DGDTDGDTDADADCDGDTDG
2342   DGDADADADGDCDADADADT
2343   DADTDADADTDGDADGDADA
2344   DCDADTDCDGDADGDGDGDC
2345   DTDTDADGDGDTDADCDTDG
2346   DCDTDADCDCDGDTDADADT
2347   DTDGDADGDADCDCDADCDT
2348   DCDADGDADADCDADADGDG
2349   DCDCDGDCDADCDTDTDADC
2350   DCDGDADCDCDADADGDTDT
2351   DGDCDGDCDTDGDGDGDTDA
2352   DADGDGDADGDADTDTDADT
2353   DTDGDCDGDGDCDTDCDTDG
2354   DADCDTDADADGDGDCDTDC
2355   DGDTDGDCDGDGDCDTDCDT
2356   DGDADCDCDADADGDADADC
2357   DTDADTDGDTDTDCDCDGDG
2358   DCDTDGDCDTDGDADCDCDG
2359   DTDGDTDGDTDTDCDTDADC
2360   DTDGDTDGDADCDCDCDADG
2361   DADTDADGDCDTDADCDTDC
2362   DTDGDCDGDADTDTDCDTDG
2363   DGDCDADGDCDADCDTDGDA
2364   DTDGDCDCDGDADADCDGDC
2365   DADGDCDADADADCDTDADC
2366   DGDCDTDGDCDTDCDTDGDA
2367   DTDTDGDADCDCDCDTDGDA
2368   DGDADADGDGDGDTDTDCDT
2369   DADTDCDCDGDCDADADCDG
2370   DTDTDADTDGDGDGDCDTDT
2371   DTDGDADGDGDTDTDGDTDA
2372   DGDADADGDTDTDCDCDGDC
2373   DADCDCDTDCDADCDCDGDC
2374   DTDGDGDTDGDGDTDGDCDT
2375   DGDGDTDADCDCDGDCDTDC
2376   DGDTDGDADGDGDGDCDADC
2377   DTDADCDTDGDGDTDCDADG
2378   DADADGDCDADCDGDTDCDT
2379   DTDCDCDCDTDGDCDCDADA
2380   DTDADADADGDGDTDGDADG
2381   DGDGDTDADADTDGDTDCDA
2382   DADGDGDTDTDGDCDTDADA
2383   DGDGDADCDADADCDGDTDT
2384   DADTDCDGDGDCDCDTDGDT
2385   DTDCDADTDGDCDADCDCDG
2386   DCDTDCDTDGDCDGDGDTDA
2387   DGDGDTDADCDTDGDTDTDA
2388   DADGDCDTDGDCDGDTDGDA
2389   DCDTDTDGDGDCDTDCDTDG
2390   DGDADGDCDGDCDGDCDTDC
2391   DGDCDCDGDTDGDCDTDADA
2392   DCDTDTDCDCDADADGDCDG
2393   DGDADCDCDADGDADTDTDA
2394   DTDCDGDCDTDADADGDTDA
2395   DCDGDCDADADTDGDGDGDC
2396   DCDADCDGDGDTDGDGDTDC
2397   DTDTDCDGDCDCDCDADGDA
2398   DADGDCDTDGDCDTDGDGDT
2399   DGDCDADGDTDGDGDTDTDT
2400   DTDCDADADADGDTDGDGDA
2401   DGDTDADADTDGDCDTDGDG
2402   DGDGDGDTDGDGDCDCDTDC
2403   DADADCDGDGDTDCDGDCDT
2404   DGDCDTDADGDTDCDCDCDG
2405   DADADGDADGDGDCDGDADG
2406   DTDGDTDTDADCDTDTDCDA
2407   DADCDADGDADADGDADADA
2408   DCDCDTDTDADADCDGDCDC
2409   DADGDCDADCDADGDGDADG
2410   DGDCDCDGDCDADCDGDCDA
2411   DCDCDCDGDCDGDCDTDGDC
2412   DTDADADCDADADADGDCDC
2413   DCDGDADADADGDGDADADG
2414   DCDTDGDADGDTDTDGDGDC
2415   DTDGDCDTDGDCDCDADCDC
2416   DGDCDTDGDADGDCDADADT
2417   DADADCDTDADGDCDADTDA
2418   DADCDCDCDCDTDTDGDGDG
2419   DGDCDCDTDCDTDADADADC
2420   DGDGDGDTDCDTDTDGDADG
2421   DGDGDGDTDTDTDTDTDTDG
2422   DCDTDGDADADADGDGDADG
2423   DGDADADCDTDADTDADTDG
2424   DCDGDCDTDCDADTDADCDG
2425   DADTDADTDGDADADCDGDT
2426   DTDGDADGDADCDTDGDCDC
2427   DGDCDTDGDADGDTDTDADT
2428   DCDADGDCDTDGDTDGDADA
2429   DCDGDADCDADTDTDCDTDG
2430   DGDCDGDTDCDTDADTDCDG
2431   DGDTDGDADADCDCDTDCDC
2432   DGDGDTDADTDCDADADCDG
2433   DCDTDGDGDADADGDGDTDG
2434   DADCDGDCDTDADADCDGDC
2435   DADGDADTDGDCDADGDCDG
2436   DADADCDGDCDTDCDGDGDC
2437   DGDTDADTDTDCDTDCDADA
2438   DCDADADGDADTDTDADADC
2439   DCDGDADCDADGDADTDTDC
2440   DADADTDCDTDCDGDTDGDG
2441   DADTDGDGDADCDGDTDTDC
2442   DADADCDADTDTDGDADGDG
2443   DADADGDGDCDADTDADADC
2444   DGDCDTDADCDTDADCDCDT
2445   DGDADTDGDTDTDTDADCDT
2446   DCDCDADADCDCDTDGDADT
2447   DTDGDTDADTDADCDADGDT
2448   DGDADCDGDADCDTDADTDT
2449   DTDADTDCDCDCDTDADADT
2450   DGDTDCDTDADCDTDTDCDC
2451   DGDGDTDCDADADTDCDCDA
2452   DTDCDTDADCDGDTDTDADA
2453   DCDCDGDADGDGDTDGDGDC
2454   DTDADTDGDTDGDTDADTDG
2455   DADCDCDGDADADCDGDADG
2456   DTDCDADADTDCDADGDADC
2457   DCDGDCDTDTDTDGDADCDT
2458   DCDTDGDGDTDADTDTDADC
2459   DTDGDTDGDADADCDADTDT
2460   DADTDTDCDGDTDCDTDCDC
2461   DGDCDGDADCDTDADCDGDA
2462   DTDGDADGDADTDGDCDCDT
2463   DGDADGDTDGDCDTDTDCDC
2464   DGDTDTDADCDTDGDGDADT
2465   DTDGDTDCDADCDCDADADG
2466   DGDCDTDTDCDCDCDGDTDC
2467   DADGDTDTDCDADADCDADA
2468   DCDCDGDADTDTDCDTDTDT
2469   DGDGDGDGDCDADCDCDGDG
2470   DADADGDTDADGDADGDGDG
2471   DTDGDTDADCDTDCDCDADA
2472   DGDADADGDADGDGDADADG
2473   DADTDGDADGDGDCDTDADG
2474   DADCDGDTDCDTDCDTDGDC
2475   DADTDGDGDADGDTDADTDG
2476   DADGDADTDGDGDADCDTDA
2477   DCDGDGDTDGDGDGDTDADC
2478   DADADTDADTDGDCDTDGDG
2479   DADTDGDGDADGDADTDGDC
2480   DGDTDTDCDADCDTDTDCDT
2481   DGDGDTDCDTDADCDTDGDA
2482   DCDTDCDGDCDTDADADCDA
2483   DTDTDADADTDADADADTDA
2484   DADGDGDADGDGDCDTDCDT
2485   DADADTDGDGDCDADCDTDC
2486   DADTDTDADGDCDCDADADT
2487   DCDADADTDCDADADGDADA
2488   DCDTDTDGDADADGDGDGDT
2489   DGDGDTDADTDCDADGDCDC
2490   DADADCDADGDCDCDTDGDA
2491   DCDADTDCDCDTDTDCDGDT
2492   DTDADTDCDCDADGDADCDC
2493   DADADGDGDGDTDCDADCDG
2494   DCDCDADADGDTDTDADADC
2495   DGDGDTDTDGDGDTDCDTDT
2496   DCDGDGDADGDADCDCDGDA
2497   DGDGDGDCDCDTDCDCDADA
2498   DADADGDCDGDTDCDCDADC
2499   DCDTDCDTDTDGDTDTDTDT
2500   DCDTDTDADADADTDADCDA
2501   DCDTDTDGDGDADGDADCDA
2502   DADCDGDGDTDGDCDGDTDT
2503   DADGDGDTDCDADADGDCDT
2504   DCDCDGDTDADCDADTDCDC
2505   DADCDCDTDGDADTDTDADA
2506   DCDCDGDADGDADTDGDADG
2507   DCDADCDGDADADCDADGDT
2508   DADTDTDADCDGDCDTDGDT
2509   DGDTDTDCDADCDTDGDGDT
2510   DADGDCDGDGDADADTDCDC
2511   DGDADGDTDGDTDTDCDGDA
2512   DCDCDTDTDTDCDTDGDGDT
2513   DADADCDGDADGDADADGDC
2514   DADADGDTDTDADGDGDTDA
2515   DTDCDCDTDADADCDGDGDT
2516   DTDCDCDADADCDTDADCDA
2517   DTDCDADADGDADCDCDGDC
2518   DTDADADTDCDCDADCDGDT
2519   DADADCDGDADCDCDTDGDC
2520   DGDADADTDGDGDTDTDADC
2521   DTDGDTDADGDCDADGDADC
2522   DTDADTDADCDGDTDTDCDA
2523   DTDCDGDTDTDADADCDCDG
2524   DTDADADCDGDTDTDGDTDT
2525   DGDCDADCDADGDADADGDA
2526   DADCDADCDADADADGDTDC
2527   DTDGDTDCDADADCDTDTDA
2528   DCDCDGDADADTDTDADCDA
2529   DADCDCDCDTDADADTDCDA
2530   DADGDADCDGDGDADTDTDG
2531   DADTDTDADADCDGDTDTDC
2532   DGDTDGDGDTDGDGDTDCDA
2533   DGDTDADTDGDGDTDADGDG
2534   DGDADADCDTDADADTDTDG
2535   DTDADCDADCDADTDTDADA
2536   DCDGDGDTDADADADGDADC
2537   DGDTDTDGDCDGDADADGDT
2538   DADTDADADGDADTDADCDC
2539   DADGDADTDGDGDTDADGDT
2540   DCDADADCDCDTDGDADADC
2541   DADCDGDTDADADADCDADA
2542   DTDADCDGDGDADTDGDCDC
2543   DCDADADTDGDGDTDTDADG
2544   DCDTDGDADADGDADGDTDT
2545   DADGDCDCDADADGDCDADG
2546   DADTDGDCDGDCDADCDTDA
2547   DADCDTDTDGDTDCDTDGDA
2548   DTDTDGDGDADCDTDGDTDA
2549   DADADTDGDTDADGDGDGDC
2550   DADADGDGDGDTDTDCDADT
2551   DCDCDADTDGDTDGDADCDC
2552   DGDCDADCDCDTDADGDTDG
2553   DGDTDCDADADCDADGDADT
2554   DTDGDADCDTDCDCDTDTDC
2555   DADCDGDADCDTDADADADG
2556   DADTDGDGDCDTDADCDGDC
2557   DADGDADCDCDADGDTDTDG
2558   DADTDTDADADCDCDCDTDG
2559   DTDGDADCDCDCDADCDTDA
2560   DCDGDCDTDCDADGDTDCDG
2561   DTDTDCDTDCDTDADADGDC
2562   DTDGDCDCDADCDCDTDADA
2563   DTDGDCDTDCDCDTDADADC
2564   DGDGDCDTDADCDADTDGDG
2565   DTDGDADADADADTDCDGDT
2566   DADGDGDGDGDADCDGDCDC
2567   DTDCDTDADADGDTDCDTDG
2568   DCDCDGDADCDCDADGDTDA
2569   DTDTDADCDGDTDTDCDGDG
2570   DTDADTDGDADCDGDCDTDG
2571   DADGDCDGDGDADADADGDT
2572   DTDTDGDGDADCDTDGDADG
2573   DADCDTDTDTDADGDGDTDT
2574   DGDGDADADCDADCDTDGDA
2575   DGDGDADCDCDADADGDTDT
2576   DCDTDADTDGDGDGDADADA
2577   DCDCDADTDGDCDCDADCDA
2578   DCDGDCDTDCDTDTDGDTDG
2579   DCDGDADGDCDCDGDCDTDG
2580   DADCDGDGDTDADADTDTDT
2581   DCDGDADCDTDTDCDADADG
2582   DTDGDGDCDTDTDGDADGDT
2583   DGDGDTDCDTDCDCDTDADA
2584   DGDTDCDTDTDGDTDGDGDT
2585   DGDADCDGDTDTDGDADCDA
2586   DCDCDADADCDCDCDTDTDG
2587   DGDCDCDTDTDCDTDTDTDT
2588   DGDTDTDGDGDTDTDCDADA
2589   DGDTDADTDTDADADCDGDA
2590   DTDGDTDGDTDTDCDTDTDC
2591   DTDTDCDCDGDTDADADCDC
2592   DGDCDTDTDADGDGDADTDT
2593   DCDCDTDTDADGDTDGDGDG
2594   DGDADGDADADCDADTDCDA
2595   DTDADTDTDGDADGDTDCDG
2596   DTDADCDADGDCDCDADADA
2597   DTDADCDTDTDCDADADCDT
2598   DTDCDTDADCDCDCDTDGDC
2599   DGDTDCDCDADTDTDGDCDG
2600   DADADCDCDTDTDADGDTDG
2601   DADTDGDADCDGDADCDCDC
2602   DTDADTDADGDADCDGDTDA
2603   DGDCDTDGDTDGDADGDTDA
2604   DCDCDADADCDCDGDADADT
2605   DADGDCDADADTDCDCDTDT
2606   DADADGDTDADCDGDCDCDG
2607   DTDTDCDCDGDTDTDCDTDC
2608   DADGDADADGDADGDTDTDA
2609   DCDTDCDADTDCDTDGDGDT
2610   DCDCDGDADTDGDADADGDC
2611   DADCDADADTDTDCDGDTDC
2612   DCDTDGDADCDTDGDCDCDT
2613   DCDGDGDGDTDADCDTDCDT
2614   DCDADCDADTDCDTDADADG
2615   DTDCDGDGDTDTDGDADGDT
2616   DTDGDADADCDCDTDADADC
2617   DGDADCDCDCDADGDTDTDT
2618   DGDADCDGDTDADCDADGDG
2619   DADCDCDGDADGDCDGDADG
2620   DADCDCDTDTDTDTDGDGDG
2621   DADTDTDGDGDGDCDGDTDA
2622   DADTDGDTDCDTDADCDTDT
2623   DTDGDCDTDADGDTDCDCDG
2624   DADGDGDTDCDCDADGDCDT
2625   DTDCDADCDGDTDCDCDADT
2626   DCDCDADCDADGDGDTDADC
2627   DTDADCDGDCDTDGDTDGDC
2628   DADGDGDADTDGDTDCDADG
2629   DTDTDCDCDGDTDTDADADG
2630   DADADTDGDCDTDGDADGDG
2631   DADCDADTDTDADCDADTDC
2632   DADCDADCDGDTDTDCDCDT
2633   DADADCDTDADCDADTDCDC
2634   DCDTDADADTDGDGDTDGDT
2635   DGDTDTDCDADGDTDADTDT
2636   DTDGDCDGDGDADADGDTDG
2637   DGDTDADCDGDGDADADADA
2638   DCDTDTDCDTDGDTDTDCDG
2639   DGDTDADCDTDADTDCDTDC
2640   DADCDGDGDGDGDADCDCDC
2641   DTDADGDTDADADADADTDC
2642   DTDTDCDADTDGDTDADCDA
2643   DADADTDTDCDCDTDGDTDA
2644   DCDCDTDGDADADCDGDADA
2645   DGDADGDTDTDADADGDGDC
2646   DADADCDADGDTDCDGDTDG
2647   DGDTDCDTDCDADTDTDGDG
2648   DGDADCDTDTDTDGDGDGDG
2649   DADADADADCDGDTDADCDA
2650   DGDGDTDTDCDTDADGDCDT
2651   DTDGDTDCDADGDADGDTDA
2652   DTDCDADGDCDTDCDADGDA
2653   DTDADTDGDTDADTDGDTDG
2654   DADTDTDCDTDTDCDGDCDA
2655   DADTDGDADGDTDTDCDADA
2656   DTDADCDGDTDTDCDCDTDA
2657   DGDCDTDADGDADADTDCDT
2658   DCDTDTDTDCDADCDTDADA
2659   DGDADADCDGDCDCDADTDT
2660   DGDADCDTDTDADCDADGDG
2661   DGDADGDADADCDCDCDTDA
2662   DTDCDGDTDGDCDCDTDTDT
2663   DADTDGDGDADCDADTDGDA
2664   DADGDADTDTDCDGDADTDA
2665   DCDADCDGDADTDTDCDCDT
2666   DADGDTDGDGDADADCDADT
2667   DADCDADADCDGDADTDGDA
2668   DCDADCDADTDTDCDADCDT
2669   DADCDCDTDCDTDADTDTDC
2670   DADTDADTDTDCDCDADADC
2671   DADADTDTDTDADTDGDGDT
2672   DGDCDADADADCDTDTDCDG
2673   DGDGDADGDGDGDGDCDADA
2674   DADADTDCDADCDTDGDTDA
2675   DTDTDGDGDADGDCDCDTDG
2676   DADTDGDGDTDADADGDADT
2677   DADADCDCDGDTDGDTDTDT
2678   DGDADGDCDADADCDCDTDA
2679   DCDGDGDCDTDGDGDGDTDG
2680   DGDADADTDADGDCDGDADC
2681   DCDCDTDTDGDGDCDTDGDA
2682   DGDADCDTDCDADGDCDGDG
2683   DTDADADCDTDTDGDGDADG
2684   DGDGDADCDGDCDADTDGDG
2685   DTDGDTDADCDADTDTDGDG
2686   DGDTDTDCDADADCDADTDT
2687   DADADCDTDTDCDGDTDADT
2688   DADTDGDADGDTDTDCDTDC
2689   DTDADADGDTDTDCDCDTDC
2690   DADTDCDADADGDCDADGDA
2691   DCDTDGDCDCDGDADCDGDA
2692   DCDGDGDGDTDCDTDADCDC
2693   DTDCDCDADCDGDGDADADG
2694   DADCDADTDTDGDGDGDCDG
2695   DCDTDTDADCDADGDTDTDA
2696   DCDGDCDCDGDADGDCDGDT
2697   DGDGDGDTDTDADADCDTDA
2698   DCDGDADGDADADCDTDCDT
2699   DGDGDTDADCDGDTDTDTDG
2700   DADCDADTDTDTDADTDGDT
2701   DTDGDADGDADADCDCDADA
2702   DTDCDGDTDCDTDADADCDT
2703   DGDGDADADGDTDADCDADC
2704   DADADTDGDGDCDTDGDGDT
2705   DGDCDCDCDGDADTDTDADG
2706   DGDCDTDCDTDADADCDADC
2707   DTDCDTDGDADGDGDGDCDT
2708   DGDGDGDADGDADCDTDGDA
2709   DADCDTDTDADGDGDGDADC
2710   DCDGDGDADCDADADTDADT
2711   DCDGDADTDTDCDCDCDTDG
2712   DTDGDGDTDTDGDGDTDADA
2713   DCDGDCDCDADADGDTDTDC
2714   DADADCDADCDTDGDTDADT
2715   DADCDADTDCDTDTDGDTDC
2716   DADGDADTDGDADGDADCDT
2717   DADCDCDCDCDTDCDTDGDA
2718   DADCDADTDCDADTDTDGDG
2719   DGDTDGDTDGDGDCDTDGDG
2720   DGDADADGDGDTDADADCDT
2721   DADCDTDTDADCDGDGDADG
2722   DADADGDTDTDCDCDGDGDT
2723   DADTDTDTDADADTDTDADA
2724   DADTDADTDTDCDTDCDCDC
2725   DTDGDTDGDGDTDGDGDCDT
2726   DCDGDADADADTDTDADADT
2727   DADCDGDADCDTDCDADCDT
2728   DADTDADGDGDGDADGDADA
2729   DCDADADTDADCDGDADCDT
2730   DADCDGDGDGDADGDGDGDT
2731   DTDTDTDCDTDTDADTDGDA
2732   DTDGDADCDTDADTDADADG
2733   DADCDCDTDADCDTDADADA
2734   DADGDTDADCDADGDADCDT
2735   DTDTDGDADGDGDTDADTDT
2736   DCDADCDTDCDCDGDGDCDT
2737   DCDADCDCDADTDGDADCDA
2738   DTDTDCDTDTDGDADADGDC
2739   DTDADADGDGDCDTDGDCDT
2740   DGDGDTDADTDTDGDADGDC
2741   DCDGDADGDTDTDTDCDCDC
2742   DTDGDADTDGDCDTDTDCDC
2743   DGDADGDTDGDTDGDTDCDA
2744   DCDGDTDTDGDADGDCDCDT
2745   DCDTDADTDGDGDGDTDTDC
2746   DCDCDTDCDTDADGDCDTDA
2747   DTDCDGDGDTDGDGDTDADA
2748   DCDTDGDCDGDGDGDGDADC
2749   DCDADGDTDGDCDTDGDGDT
2750   DTDCDGDTDTDADCDGDADG
2751   DCDGDADCDCDADADGDTDG
2752   DTDGDGDCDGDADCDTDTDA
2753   DGDTDGDGDADADADGDGDC
2754   DTDADADGDCDGDADADADG
2755   DTDTDCDCDGDTDADADGDT
2756   DTDADADTDCDADTDGDGDA
2757   DGDTDADTDCDGDCDGDADT
2758   DADADGDADTDGDCDTDTDG
2759   DADGDADADGDTDADTDGDA
2760   DTDADCDTDCDTDTDTDGDG
2761   DADADTDTDADCDGDTDADT
2762   DGDGDGDTDADGDGDCDADA
2763   DTDADCDGDTDCDCDCDADC
2764   DADTDTDCDGDTDTDTDCDC
2765   DTDCDADADGDADCDTDADT
2766   DCDGDGDTDGDCDGDGDTDA
2767   DTDTDCDCDADTDGDADADG
2768   DADGDTDADCDADCDADCDG
2769   DADGDADTDGDGDTDCDADA
2770   DTDTDTDCDADGDTDTDADT
2771   DTDTDADCDADADTDCDADC
2772   DGDADADADGDGDADGDGDA
2773   DTDADADCDCDADTDADTDG
2774   DTDGDTDTDGDGDGDCDADG
2775   DCDCDGDCDADADTDADCDC
2776   DTDADTDCDGDCDTDADTDA
2777   DTDCDTDGDGDCDGDCDTDC
2778   DADGDGDCDTDADTDCDADG
2779   DTDGDGDTDCDADGDADADC
2780   DGDCDTDCDADGDGDCDCDA
2781   DADADADTDGDADTDTDGDC
2782   DCDGDCDTDCDADGDADCDC
2783   DGDCDTDGDCDTDGDGDTDC
2784   DGDTDCDGDTDCDADADGDC
2785   DTDADTDGDGDADADADTDC
2786   DADTDGDADGDGDCDADGDA
2787   DCDGDADADCDADTDCDCDA
2788   DGDADADTDGDCDTDGDADC
2789   DCDTDADTDCDGDTDTDGDC
2790   DADADGDCDTDCDGDADADG
2791   DTDADADADCDTDTDGDADG
2792   DGDADADGDCDGDTDCDCDG
2793   DCDCDGDADGDTDTDGDADC
2794   DCDTDCDADCDADGDADADC
2795   DADTDGDCDADGDADADGDG
2796   DTDCDCDADADGDCDTDADT
2797   DTDGDGDGDTDCDTDADTDC
2798   DCDGDADGDCDGDGDCDTDA
2799   DTDCDGDGDADGDADGDADG
2800   DTDADTDGDCDTDTDGDADA
2801   DGDGDTDTDCDCDTDCDADA
2802   DTDGDGDADCDCDGDCDADT
2803   DTDADADGDCDGDADGDTDC
2804   DADCDADGDADADGDGDADC
2805   DADGDTDTDCDADTDTDCDG
2806   DGDGDADADGDCDCDADADT
2807   DADTDGDGDTDADADCDTDG
2808   DADGDADADCDTDADTDCDG
2809   DCDCDGDTDGDADCDTDADC
2810   DCDADADGDCDADADTDCDT
2811   DTDCDGDCDADCDADGDCDA
2812   DADCDTDTDGDGDTDGDGDT
2813   DADCDTDCDADADADGDTDG
2814   DCDTDGDCDADADGDTDCDA
2815   DGDADTDTDGDADCDGDADA
2816   DADTDCDTDADTDADADGDA
2817   DGDCDGDADADCDADGDADA
2818   DADCDADGDADADGDADGDT
2819   DADADGDCDTDADCDADGDA
2820   DTDGDGDTDTDCDTDGDGDA
2821   DCDCDCDADCDTDGDGDCDT
2822   DADTDCDADTDGDGDGDGDT
2823   DCDTDTDCDCDGDCDTDGDC
2824   DGDADGDTDGDCDTDTDADC
2825   DGDCDADTDCDCDGDGDTDG
2826   DCDGDTDTDCDGDADCDTDC
2827   DTDADADGDTDCDCDADCDA
2828   DADCDTDADADGDGDCDADC
2829   DCDTDADTDTDGDTDTDGDC
2830   DCDGDCDTDADADADGDGDA
2831   DADCDCDADADGDADCDGDG
2832   DGDGDADGDGDTDADADTDG
2833   DADGDCDTDADTDGDADGDT
2834   DADADADADTDTDGDADADT
2835   DCDTDGDCDCDCDTDTDCDA
2836   DADGDCDGDGDCDADCDADA
2837   DCDCDGDGDGDADCDTDCDT
2838   DCDTDCDGDGDTDTDADCDG
2839   DTDGDGDTDGDGDTDGDCDT
2840   DGDGDADGDGDTDADTDGDG
2841   DGDCDTDADTDCDGDTDGDC
2842   DADGDCDADADCDCDADCDT
2843   DCDADGDGDCDCDGDADADC
2844   DADGDCDCDADADGDGDTDC
2845   DADADGDCDCDTDADTDTDG
2846   DGDADCDADCDCDADTDTDG
2847   DGDTDCDGDGDTDTDCDGDC
2848   DTDADADGDGDCDTDGDGDT
2849   DGDCDCDGDADTDADTDGDT
2850   DADTDADCDCDGDCDTDADA
2851   DGDGDADADCDADADCDGDA
2852   DGDCDADCDGDADGDADCDC
2853   DTDADGDCDTDGDADTDGDA
2854   DADCDGDCDTDCDTDADADC
2855   DGDADGDADTDTDADTDCDC
2856   DGDTDADADGDCDTDGDADC
2857   DCDCDCDTDGDADGDCDADA
2858   DCDGDTDCDGDADGDADADG
2859   DCDTDCDTDCDADADCDADA
2860   DCDGDGDGDADCDCDCDTDT
2861   DCDTDGDTDADTDCDADGDG
2862   DADTDGDADCDCDCDADTDA
2863   DCDGDCDTDADTDGDGDADA
2864   DGDCDADCDTDCDCDGDADG
2865   DTDCDADADGDADCDTDGDG
2866   DTDCDGDTDADADCDGDCDT
2867   DGDCDGDTDADTDCDTDTDG
2868   DTDGDGDADCDGDADTDGDA
2869   DCDGDTDTDADTDGDCDADG
2870   DADADGDADTDADADADADG
2871   DADGDGDGDTDGDTDCDTDT
2872   DCDCDGDTDADCDTDCDGDC
2873   DGDADADGDADGDADTDGDG
2874   DADADGDADGDTDADTDCDG
2875   DCDCDADTDADGDTDCDGDC
2876   DCDTDTDCDADADGDADGDG
2877   DGDCDGDCDTDADADGDGDT
2878   DADTDADCDGDCDTDGDADG
2879   DCDADGDTDTDCDGDGDCDA
2880   DTDCDGDADCDCDCDTDGDA
2881   DGDGDADCDGDTDTDGDADT
2882   DTDADTDCDADGDCDGDTDG
2883   DGDTDTDTDCDADADCDGDG
2884   DGDGDADCDADTDTDADCDC
2885   DGDADGDCDGDTDADADCDA
2886   DTDCDTDCDGDCDTDGDTDA
2887   DTDGDGDTDGDCDGDCDADT
2888   DGDADTDADADCDTDTDCDT
2889   DTDGDADGDCDCDADGDCDA
2890   DADGDCDTDCDADGDADADG
2891   DGDGDCDGDCDTDADTDCDA
2892   DTDGDADADCDADGDCDCDG
2893   DADGDTDGDGDADADCDTDC
2894   DADADCDGDGDTDGDTDCDC
2895   DTDTDCDADADGDADCDCDC
2896   DTDGDADTDADTDGDCDTDG
2897   DCDGDTDCDGDTDCDCDADG
2898   DADCDTDCDTDGDCDTDGDA
2899   DCDTDTDCDTDTDTDGDADG
2900   DADADGDTDADTDADTDCDG
2901   DADCDADADCDGDGDTDCDT
2902   DGDGDTDTDADCDTDGDGDC
2903   DGDCDADADTDCDCDCDADT
2904   DCDTDGDADTDGDCDTDCDA
2905   DADGDCDCDADCDADCDADG
2906   DCDTDTDADTDADADGDCDC
2907   DADADGDCDGDTDTDCDADG
2908   DTDGDADCDGDCDTDTDCDT
2909   DADGDCDCDGDTDGDCDTDG
2910   DGDTDGDGDTDGDCDTDGDA
2911   DCDTDTDCDCDTDGDADTDG
2912   DCDGDADGDTDCDGDGDTDG
2913   DADCDADADGDADADGDGDT
2914   DADADCDADCDTDTDADADC
2915   DGDGDADGDCDCDADCDTDA
2916   DCDGDADCDTDTDADCDCDG
2917   DADGDADGDTDTDGDADTDT
2918   DGDGDTDGDADGDGDADADC
2919   DADGDTDGDGDADADCDGDC
2920   DTDCDTDCDADTDGDGDTDC
2921   DADCDADGDCDADCDADADC
2922   DGDTDTDCDTDCDADGDTDT
2923   DTDGDADGDADCDTDGDADC
2924   DGDCDGDADADGDCDTDGDA
2925   DADCDGDADGDCDADGDTDA
2926   DTDCDGDCDTDTDGDADADG
2927   DADTDTDADADCDTDCDTDG
2928   DCDGDCDTDGDADADCDCDA
2929   DADGDADGDGDADCDCDCDA
2930   DADGDGDADCDADGDCDTDT
2931   DGDGDGDADGDADTDGDCDT
2932   DTDCDADADGDGDTDADTDC
2933   DADADGDGDCDTDGDADADC
2934   DTDADGDADTDADADGDGDT
2935   DCDCDADADCDCDTDGDADT
2936   DGDADGDCDADGDADTDGDA
2937   DCDADCDCDADCDADADCDG
2938   DTDGDADGDTDGDGDCDTDA
2939   DADTDCDTDCDCDGDCDADC
2940   DADGDGDADADCDADADGDT
2941   DTDCDADGDADADTDCDADG
2942   DADTDGDADADCDGDCDADT
2943   DGDGDADCDGDADADADGDC
2944   DTDCDADGDGDCDCDADADG
2945   DGDCDTDCDTDGDGDADCDG
2946   DADTDTDCDCDADTDGDADA
2947   DGDTDCDADADTDGDADADC
2948   DADADADCDTDTDGDADCDG
2949   DTDADADTDCDGDADCDADA
2950   DGDCDADADTDTDCDCDADG
2951   DADADGDCDGDADADTDCDA
2952   DADCDGDGDTDGDADGDTDG
2953   DGDGDTDCDTDCDADADCDG
2954   DGDADTDTDTDTDADADGDG
2955   DADTDADTDGDCDCDADGDT
2956   DCDADADCDGDADGDADADC
2957   DADCDTDGDGDTDGDADGDT
2958   DTDCDADADGDCDADTDADG
2959   DCDGDADTDADTDGDGDTDT
2960   DADADCDTDADCDGDCDCDA
2961   DADTDADADGDADADGDCDT
2962   DCDGDCDTDGDADGDADTDT
2963   DGDADCDADGDTDADTDGDG
2964   DADCDADTDTDCDCDADGDA
2965   DCDGDGDTDGDCDCDADADG
2966   DGDADTDGDCDTDADTDGDA
2967   DADGDTDTDGDADADGDTDA
2968   DCDCDTDTDCDADADGDCDG
2969   DGDADCDTDCDTDADADGDG
2970   DADCDGDGDADGDCDADTDT
2971   DCDCDGDTDADCDADGDCDC
2972   DADTDCDGDGDADADCDCDA
2973   DTDGDGDTDCDADCDTDGDA
2974   DCDGDCDTDGDGDTDCDADA
2975   DGDADGDTDGDGDTDCDTDG
2976   DCDCDGDCDTDGDTDGDADT
2977   DTDADADCDGDGDTDADADG
2978   DTDTDADCDCDADGDADADC
2979   DGDADADCDCDCDCDADGDC
2980   DTDADTDGDGDADTDGDCDT
2981   DCDTDGDCDGDCDADGDADA
2982   DTDCDCDGDCDADADTDGDC
2983   DTDGDADCDCDCDTDCDADG
2984   DTDTDGDADTDTDGDCDTDG
2985   DCDGDCDTDADTDADCDCDC
2986   DADGDADCDCDADADGDCDT
2987   DGDADGDCDTDADTDTDCDC
2988   DTDGDADCDGDADTDGDGDA
2989   DCDADTDGDADTDGDGDADC
2990   DADADGDCDADGDGDGDTDA
2991   DTDTDGDADCDCDCDTDCDA
2992   DGDGDTDTDADTDTDCDTDT
2993   DGDADTDGDCDCDGDADCDC
2994   DGDADCDTDGDADCDTDGDT
2995   DTDADADGDCDGDGDTDCDC
2996   DADADADGDADGDCDADADC
2997   DGDCDTDTDTDGDADGDGDA
2998   DTDGDADTDADADADGDCDA
2999   DTDTDCDGDADGDTDCDTDG
3000   DCDADCDTDGDADADTDGDC
3001   DADTDCDTDADADGDGDCDT
3002   DCDCDTDGDADGDADTDTDG
3003   DCDCDCDGDTDADTDGDCDC
3004   DADGDCDGDTDCDADCDTDG
3005   DCDGDCDGDADADTDCDTDG
3006   DCDADCDGDTDADADGDADT
3007   DTDTDADTDGDADCDTDCDC
3008   DGDTDTDADADGDTDADTDC
3009   DGDCDTDCDGDGDGDGDADA
3010   DCDGDADADADGDCDADTDG
3011   DGDCDTDADTDGDGDADGDC
3012   DADGDADTDGDADCDCDADA
3013   DGDTDTDCDCDTDTDADADG
3014   DGDADADTDCDTDADCDCDT
3015   DADCDADCDGDTDTDCDADC
3016   DTDGDGDTDGDADTDGDADT
3017   DGDTDTDGDADCDGDGDTDG
3018   DADTDADCDCDGDTDTDGDG
3019   DTDGDTDGDADTDTDCDCDT
3020   DADADGDADADTDADTDGDA
3021   DTDGDCDADGDGDTDTDADA
3022   DCDTDCDTDGDADCDCDCDG
3023   DADADADTDCDADTDGDGDG
3024   DADGDCDADADGDGDTDCDG
3025   DGDGDADTDADTDTDCDTDG
3026   DGDADGDGDADADGDCDADC
3027   DGDTDADADGDGDGDADADT
3028   DCDADTDTDGDCDGDADGDC
3029   DADADCDCDCDTDTDGDGDA
3030   DTDADADCDCDADADTDADA
3031   DGDCDADADCDTDGDADCDC
3032   DADTDGDTDADTDTDCDTDC
3033   DADADGDGDTDGDADCDTDC
3034   DCDADTDTDTDADCDCDTDT
3035   DADTDGDGDADCDADCDCDA
3036   DCDADGDGDTDCDADADGDT
3037   DCDADGDADGDTDCDCDGDA
3038   DTDADCDGDADCDADADADG
3039   DADGDTDTDADCDTDCDTDC
3040   DGDADADGDGDTDCDTDGDG
3041   DADGDTDGDADGDADADCDC
3042   DADGDADADGDADADADCDT
3043   DCDGDADADGDADGDADADA
3044   DGDCDTDCDGDTDGDADGDA
3045   DADGDGDCDTDCDTDGDGDC
3046   DTDGDADTDGDTDGDADADC
3047   DADADGDCDGDADGDCDADC
3048   DCDTDADTDADGDTDTDGDC
3049   DCDGDCDTDADCDGDADADG
3050   DGDCDCDCDGDTDGDADADG
3051   DCDTDGDCDTDGDCDTDADA
3052   DADCDGDADGDTDCDCDGDA
3053   DGDADGDADADADCDGDTDA
3054   DADADCDADGDADCDTDCDC
3055   DTDADADGDTDTDCDADTDC
3056   DTDADCDGDGDADCDGDTDA
3057   DADGDGDADGDTDADADCDT
3058   DADADADGDGDCDTDADCDA
3059   DTDADADGDGDADGDGDCDC
3060   DCDTDADADADTDGDGDADT
3061   DADADGDTDADCDGDADTDA
3062   DADGDADADCDGDTDADCDC
3063   DADADGDTDGDADTDTDADT
3064   DGDADTDGDGDTDCDTDGDT
3065   DTDCDCDADADADADGDGDC
3066   DTDGDCDTDGDADTDGDCDC
3067   DADADCDGDGDGDGDTDCDT
3068   DCDTDTDADTDGDADCDCDT
3069   DTDTDTDADCDGDTDADADA
3070   DGDTDCDGDCDTDTDGDGDA
3071   DCDADGDADADTDCDADCDG
3072   DADTDTDTDGDTDGDCDCDT
3073   DADCDADGDCDADADADADT
3074   DCDTDADADGDADCDTDGDG
3075   DADCDCDADTDTDADGDGDC
3076   DADTDGDADTDGDCDADADT
3077   DTDTDADCDCDADADGDGDC
3078   DADADCDCDGDCDTDADADG
3079   DGDCDCDCDTDCDGDGDTDC
3080   DTDGDCDGDADGDTDTDADC
3081   DCDGDADTDGDGDTDCDCDA
3082   DGDADCDGDADCDGDADCDC
3083   DGDADCDTDGDADADCDCDC
3084   DTDGDADGDTDTDADGDCDT
3085   DADTDTDADADTDGDCDTDG
3086   DCDCDGDCDTDADADGDCDA
3087   DADCDTDTDGDCDADGDGDT
3088   DCDTDGDGDTDADGDGDGDA
3089   DADGDTDTDTDGDADTDGDG
3090   DCDGDADTDGDADADCDTDC
3091   DADADADGDCDTDGDCDCDC
3092   DTDTDGDCDGDTDADCDADA
3093   DCDCDADADGDGDCDGDADG
3094   DGDGDADCDGDCDTDTDGDG
3095   DGDTDADADTDCDCDADCDA
3096   DADCDTDTDGDADGDGDCDG
3097   DTDADCDTDCDTDADADGDG
3098   DGDADGDADCDTDTDCDGDC
3099   DADTDCDADADTDCDTDCDT
3100   DGDADGDGDADGDGDGDADC
3101   DGDTDADADCDTDADCDADT
3102   DGDCDGDTDADADCDCDTDT
3103   DCDTDGDGDADTDGDTDTDG
3104   DCDTDADADGDTDCDADCDC
3105   DTDADTDGDGDCDTDGDGDA
3106   DCDADGDTDTDGDGDADADA
3107   DCDTDTDTDTDGDGDTDGDG
3108   DCDADTDADADCDCDCDCDA
3109   DADADGDGDGDTDADADADG
3110   DGDCDADTDTDCDCDGDGDC
3111   DTDGDADGDGDTDADGDGDA
3112   DTDTDGDGDCDTDGDGDADA
3113   DTDTDGDGDTDCDADCDADA
3114   DGDCDADGDADADADGDTDA
3115   DADCDADCDADGDGDADADC
3116   DTDTDCDCDTDGDADGDTDC
3117   DCDADCDADADGDTDTDTDT
3118   DGDADCDGDTDTDADADGDG
3119   DGDTDADTDCDGDADADCDA
3120   DGDGDADGDGDCDTDADCDG
3121   DGDCDGDADADADCDCDADT
3122   DTDCDGDCDCDADADGDGDA
3123   DCDTDTDTDTDGDGDGDADG
3124   DADCDCDCDADCDGDGDADG
3125   DADADADCDADCDTDTDGDA
3126   DCDGDADGDTDADCDADADC
3127   DADGDTDCDGDTDTDCDADA
3128   DCDCDTDTDCDTDTDCDGDG
3129   DADTDTDCDADADADADADT
3130   DGDCDTDGDCDCDGDADADG
3131   DCDTDGDADADCDTDCDTDC
3132   DCDADADCDTDCDADGDTDC
3133   DGDCDTDGDGDGDADTDGDG
3134   DCDTDTDTDCDCDGDTDGDC
3135   DTDGDGDTDCDGDTDCDTDC
3136   DGDADTDADADTDGDGDTDT
3137   DTDTDGDADTDGDTDGDTDT
3138   DTDADADADGDADCDADCDC
3139   DADTDTDADCDGDCDCDGDA
3140   DCDTDCDGDCDTDGDGDADA
3141   DCDTDCDTDCDADCDADTDC
3142   DTDGDGDADCDTDCDCDADG
3143   DADGDGDADGDTDTDADGDA
3144   DGDADADGDADTDTDCDGDA
3145   DADCDADGDADGDGDTDTDA
3146   DADGDADADCDCDCDTDGDC
3147   DGDTDADCDADTDCDADADC
3148   DGDTDTDGDTDADADCDTDG
3149   DGDTDGDGDTDTDCDCDCDC
3150   DTDGDADGDADADCDCDTDC
3151   DGDADTDGDADCDCDTDCDA
3152   DTDTDADADADTDTDGDGDC
3153   DTDADADCDGDADGDADADC
3154   DTDTDTDGDADGDADADTDG
3155   DADCDTDCDCDCDGDCDGDC
3156   DTDGDCDCDGDADGDGDCDT
3157   DGDGDCDCDTDADGDGDTDG
3158   DCDCDADADADCDTDGDADG
3159   DTDGDCDTDGDGDTDADTDT
3160   DADTDTDGDGDTDGDCDTDG
3161   DGDTDGDTDGDGDADCDCDC
3162   DGDCDTDTDADGDCDTDADT
3163   DGDTDTDCDCDTDADTDGDG
3164   DTDCDGDGDTDGDTDCDADC
3165   DTDGDGDTDADADGDGDGDC
3166   DTDTDTDADADGDTDTDADA
3167   DTDCDADADTDADADGDGDC
3168   DTDCDTDTDGDTDADGDTDT
3169   DGDGDTDGDCDCDGDADADA
3170   DGDTDGDCDTDGDCDTDCDT
3171   DGDADADCDGDTDTDGDCDA
3172   DTDCDCDGDADADGDGDTDC
3173   DTDCDCDGDTDADCDCDTDC
3174   DCDGDTDADGDCDTDGDGDT
3175   DGDGDTDGDADCDGDCDADG
3176   DADCDTDADTDGDCDGDGDG
3177   DTDGDCDTDGDCDCDTDTDA
3178   DGDGDTDGDGDCDTDTDTDG
3179   DTDGDTDTDTDGDGDCDGDC
3180   DADGDGDCDADTDGDTDCDT
3181   DGDCDADADTDCDADGDTDG
3182   DADCDGDCDTDGDTDADGDC
3183   DTDGDCDTDGDGDADCDTDG
3184   DADADADCDGDCDADGDTDA
3185   DADADCDCDADGDADADGDC
3186   DTDGDADGDTDTDCDGDADC
3187   DADADTDGDADGDTDTDCDA
3188   DTDCDGDGDTDCDCDTDADT
3189   DGDADTDGDCDGDADTDTDG
3190   DGDADADGDCDCDCDGDTDG
3191   DADGDADCDADGDCDADCDG
3192   DADADADCDGDCDCDADADC
3193   DTDCDTDGDCDGDGDADCDC
3194   DTDCDTDCDTDCDGDGDADT
3195   DGDADADCDADCDTDGDADG
3196   DADADCDADTDGDADADGDT
3197   DTDTDGDADADGDGDTDGDA
3198   DADCDADTDADADTDGDGDT
3199   DGDTDCDCDCDTDTDADTDG
3200   DADGDGDADCDTDTDADCDC
3201   DADADCDADGDADGDADGDA
3202   DGDGDTDGDCDCDGDTDGDG
3203   DTDGDTDTDADCDADTDGDA
3204   DTDGDGDCDTDCDCDGDTDT
3205   DCDTDADADGDTDGDCDADA
3206   DGDCDADADCDCDCDADADT
3207   DCDADADCDCDCDTDADADG
3208   DADCDTDCDTDADADADADG
3209   DADGDTDTDCDTDCDCDGDA
3210   DGDGDTDTDGDADCDCDCDT
3211   DGDADGDADADGDGDCDTDG
3212   DCDGDCDGDADGDGDADADT
3213   DCDADADADCDTDGDGDCDT
3214   DGDGDGDTDTDCDADCDCDG
3215   DADGDADTDTDGDGDCDTDT
3216   DGDADADGDADCDCDTDTDG
3217   DGDGDGDTDCDTDGDADCDG
3218   DADTDGDCDTDGDADCDADT
3219   DCDCDGDTDADGDADGDTDG
3220   DGDCDTDADTDCDGDADCDC
3221   DTDCDGDTDTDCDGDCDTDC
3222   DTDCDCDTDADCDTDGDGDT
3223   DADTDGDCDADGDTDCDTDG
3224   DGDTDGDCDCDTDCDADGDG
3225   DTDADADGDTDTDCDGDGDT
3226   DGDCDADADCDADGDCDTDT
3227   DCDTDGDADCDADTDCDCDA
3228   DTDGDADGDADGDADCDTDT
3229   DCDADTDGDGDTDADCDTDG
3230   DADCDCDADGDCDGDTDADC
3231   DTDTDADTDADADTDGDADC
3232   DTDTDGDTDADCDADADADG
3233   DCDADADTDGDTDCDTDGDA
3234   DCDGDCDTDADTDGDADADA
3235   DGDADCDCDCDTDGDADGDT
3236   DTDCDTDCDTDADCDTDGDG
3237   DCDGDGDCDGDCDTDADADG
3238   DADTDGDTDCDCDCDGDTDG
3239   DADADGDADADADCDTDCDG
3240   DADTDADCDADCDTDADTDC
3241   DTDADCDCDGDTDADGDADG
3242   DCDGDGDCDADCDTDADGDC
3243   DTDADTDTDGDADGDCDGDT
3244   DCDCDADGDADADCDTDADC
3245   DADGDADADGDGDCDADCDT
3246   DCDADCDTDCDCDGDTDCDT
3247   DGDADGDADGDADADTDCDG
3248   DTDTDADTDGDGDADCDADT
3249   DCDADTDTDADADGDCDGDT
3250   DCDADCDTDTDTDGDADCDA
3251   DCDCDADADGDCDGDTDGDA
3252   DADCDTDTDADTDGDGDADA
3253   DADADCDCDCDADGDCDADA
3254   DTDADTDTDCDGDGDTDADA
3255   DCDADCDADADADGDGDCDT
3256   DGDTDGDADGDTDADTDCDT
3257   DTDCDCDCDTDGDADGDADG
3258   DTDCDGDCDCDADCDADADA
3259   DGDGDTDADCDTDTDADCDG
3260   DTDTDCDCDTDCDADCDGDT
3261   DADTDADTDGDADCDCDGDT
3262   DCDADTDGDCDCDADADGDG
3263   DCDGDCDTDGDADTDGDADT
3264   DTDCDADADCDGDCDTDADC
3265   DGDGDTDGDCDCDGDADADG
3266   DGDTDTDTDGDCDADGDGDA
3267   DADGDGDGDADTDTDGDCDC
3268   DCDGDCDTDCDADTDGDGDA
3269   DTDGDADADCDADGDCDTDA
3270   DCDGDTDCDTDCDCDADGDA
3271   DCDCDTDGDADGDGDTDCDA
3272   DADGDGDCDCDADGDADGDT
3273   DCDGDADTDGDADGDADTDG
3274   DCDTDTDADADGDGDADADT
3275   DTDADCDADCDGDGDGDGDT
3276   DGDADADGDGDADADGDTDA
3277   DADCDADCDCDADGDADGDA
3278   DTDGDGDTDADGDADGDADA
3279   DGDTDADCDGDCDTDADTDG
3280   DGDADTDADADGDGDCDTDT
3281   DADTDGDGDTDADTDCDTDC
3282   DCDCDADCDTDCDADGDADC
3283   DCDADGDTDTDCDADCDCDA
3284   DADCDADGDTDTDCDCDADT
3285   DADADTDADGDADADGDADG
3286   DADADCDADTDTDGDADGDG
3287   DGDCDTDTDADGDTDADGDG
3288   DTDADTDCDGDADGDADADT
3289   DADADCDTDCDADTDTDCDC
3290   DTDTDGDADGDGDCDADCDG
3291   DTDADADCDTDTDGDTDTDT
3292   DGDADTDTDCDGDGDADCDC
3293   DTDADTDCDCDADTDCDADC
3294   DTDADTDGDCDCDADGDADC
3295   DGDGDADCDADGDCDADADT
3296   DTDCDTDCDADGDTDGDADA
3297   DTDGDADCDCDTDADADGDG
3298   DGDADCDTDTDCDGDADTDA
3299   DTDGDTDTDCDCDGDCDADT
3300   DCDADTDGDCDCDADGDCDG
3301   DTDADTDGDADCDCDGDCDC
3302   DGDTDGDTDCDADADTDGDG
3303   DTDGDADCDADTDCDGDCDC
3304   DADTDCDADTDGDGDGDGDT
3305   DCDTDADCDTDGDGDTDADA
3306   DADADCDCDADCDTDADADG
3307   DGDADADCDTDTDADADGDG
3308   DADTDGDADGDADTDTDTDT
3309   DGDGDCDTDCDTDCDADADA
3310   DGDCDGDADADADGDCDTDG
3311   DADGDGDGDADGDADCDGDG
3312   DTDADADGDADADGDADCDT
3313   DGDGDCDGDADGDGDTDADC
3314   DADTDGDCDTDTDTDADADT
3315   DGDGDADTDADCDCDGDTDT
3316   DADADGDADTDTDCDTDTDA
3317   DCDTDGDGDTDCDGDTDGDC
3318   DTDADGDADCDGDCDADADT
3319   DCDADGDGDADCDADCDTDG
3320   DTDGDTDGDGDGDADADADC
3321   DCDTDCDADCDTDGDCDGDT
3322   DGDCDCDADTDCDADADTDG
3323   DADCDCDTDADGDGDGDTDT
3324   DCDTDTDCDGDCDTDADADG
3325   DADADCDGDCDCDTDADCDA
3326   DTDGDGDGDTDGDCDTDCDA
3327   DGDADADCDADTDTDADCDG
3328   DGDADGDADTDTDGDCDTDG
3329   DGDGDADTDGDADTDTDGDT
3330   DCDADCDTDGDGDTDADADC
3331   DGDTDTDCDGDTDGDCDTDC
3332   DTDADGDGDGDCDADTDGDG
3333   DTDADTDCDCDCDADADTDT
3334   DCDTDGDCDGDTDGDADTDA
3335   DCDADCDTDCDTDADCDADA
3336   DGDTDCDTDADADADCDCDA
3337   DGDTDTDTDCDADGDCDTDA
3338   DADGDGDADADCDTDCDADA
3339   DGDGDADADCDTDCDCDADT
3340   DGDCDGDTDCDTDCDTDGDT
3341   DTDCDGDGDGDADADGDGDA
3342   DGDGDTDGDGDADCDCDADG
3343   DTDTDGDADTDTDCDGDGDC
3344   DCDTDADADADCDGDTDGDC
3345   DTDGDADCDADTDTDGDTDG
3346   DCDADGDCDGDCDCDTDADA
3347   DGDGDGDADADGDCDADADC
3348   DTDGDADTDADCDCDGDGDA
3349   DCDCDTDGDCDCDGDTDGDG
3350   DCDGDADADCDADTDCDGDT
3351   DADGDGDGDADCDCDTDTDG
3352   DADADGDTDADTDTDCDADA
3353   DCDADCDADGDGDADADCDT
3354   DGDGDCDTDGDCDTDCDGDC
3355   DTDCDTDCDCDGDTDGDGDA
3356   DCDTDADADGDCDTDADCDT
3357   DGDADADCDGDGDADADCDC
3358   DADCDTDADADCDTDADCDC
3359   DTDTDCDTDGDGDADTDGDC
3360   DTDGDCDGDCDGDTDCDADA
3361   DGDGDTDADTDGDCDTDTDG
3362   DGDGDGDADTDGDTDTDADT
3363   DTDADGDTDGDCDCDADCDC
3364   DCDTDADADCDADGDGDTDA
3365   DADGDADCDTDADCDCDCDG
3366   DCDTDGDGDGDADGDADADA
3367   DGDADADGDGDCDTDTDCDC
3368   DTDTDCDGDTDGDGDTDGDC
3369   DCDTDCDCDGDTDADADCDT
3370   DCDCDTDGDADGDCDADGDA
3371   DTDGDGDCDTDGDGDCDADT
3372   DCDADADGDTDCDTDCDTDC
3373   DADTDCDADADGDGDADADC
3374   DADTDADTDGDGDTDADCDG
3375   DCDGDGDTDGDADGDGDADC
3376   DGDGDGDADADGDTDTDTDA
3377   DCDCDGDTDTDADADGDGDA
3378   DCDADADGDCDADADGDCDG
3379   DTDTDCDTDCDTDADTDGDG
3380   DADCDCDCDADCDGDGDGDC
3381   DTDADTDGDGDADCDTDTDA
3382   DTDGDGDADGDADCDTDGDG
3383   DCDTDGDADCDADADGDGDT
3384   DADGDCDTDGDADTDGDADG
3385   DGDCDADADTDGDCDTDGDC
3386   DGDTDCDCDADCDADTDADA
3387   DGDGDTDGDTDCDCDTDTDA
3388   DCDADGDGDADTDTDCDCDC
3389   DADTDGDCDGDTDTDCDGDG
3390   DADGDCDADCDTDADGDGDT
3391   DADADGDADTDGDGDTDTDA
3392   DTDGDCDADGDTDTDTDADA
3393   DGDTDCDTDTDTDCDADCDT
3394   DADTDCDADADGDTDCDCDC
3395   DTDTDADADCDTDCDTDADA
3396   DGDTDTDCDCDTDGDCDGDA
3397   DADCDCDTDTDCDTDADTDG
3398   DADTDGDGDADTDADCDADA
3399   DGDADADCDADADCDCDGDA
3400   DGDCDGDADTDTDGDADCDG
3401   DCDTDGDCDGDCDTDGDADG
3402   DCDADTDCDADTDCDADCDC
3403   DTDCDTDADTDGDGDGDTDC
3404   DTDCDGDCDTDGDGDTDGDG
3405   DTDTDTDCDTDADTDGDCDT
3406   DADTDGDGDCDTDGDCDADC
3407   DADCDGDTDCDADADADGDC
3408   DADTDADCDGDCDTDCDTDG
3409   DCDCDTDADADGDGDADGDA
3410   DADADCDGDTDADADGDGDA
3411   DGDTDADCDTDTDGDGDADG
3412   DCDGDTDGDCDADCDTDGDG
3413   DADCDCDCDADADCDCDADT
3414   DGDADTDTDGDCDCDCDADC
3415   DGDCDTDGDCDGDTDTDADT
3416   DCDTDCDGDTDADGDTDTDC
3417   DTDCDADADTDTDGDGDGDT
3418   DGDCDTDCDCDTDTDTDGDG
3419   DCDTDADTDGDGDTDTDGDA
3420   DCDCDTDADGDTDTDGDGDT
3421   DGDGDTDGDTDTDTDTDADG
3422   DGDGDTDTDCDGDADGDTDC
3423   DCDTDCDCDADADGDADTDG
3424   DGDCDTDCDGDCDTDCDTDA
3425   DCDGDADTDTDCDTDADCDC
3426   DTDADADGDGDADCDADCDC
3427   DGDTDGDADADGDGDADADC
3428   DGDTDGDADCDCDCDADADA
3429   DCDADADADCDCDGDTDADC
3430   DADCDCDTDCDTDADGDADG
3431   DADGDGDTDADADTDGDGDG
3432   DCDGDCDTDADTDGDGDGDT
3433   DTDCDADADADCDCDTDTDC
3434   DTDGDGDADADCDADGDADT
3435   DGDCDCDTDTDCDGDGDCDT
3436   DGDGDCDTDTDTDGDTDGDG
3437   DCDTDADADCDGDTDADGDG
3438   DGDGDCDTDADCDCDTDTDA
3439   DADTDGDADADTDGDCDTDG
3440   DCDTDGDGDCDGDTDGDGDT
3441   DCDADADCDTDCDADCDCDT
3442   DADADTDADADADGDCDADA
3443   DCDCDGDADGDCDADGDGDA
3444   DCDTDTDCDADTDGDADCDT
3445   DGDGDTDCDTDTDADTDGDA
3446   DADCDTDCDCDADCDADADA
3447   DADGDADGDTDTDADGDTDA
3448   DCDCDGDADADCDGDADCDC
3449   DCDADTDTDGDADCDTDCDA
3450   DADCDADGDCDTDTDGDTDG
3451   DTDTDGDADADGDADTDTDT
3452   DADTDGDADGDGDCDGDADA
3453   DCDGDGDTDGDTDTDADADC
3454   DTDTDGDADGDGDGDADGDC
3455   DGDTDADGDGDADADADTDA
3456   DADTDADCDGDADCDTDCDA
3457   DCDTDADTDADGDGDGDADG
3458   DADGDGDCDGDADADADTDA
3459   DADTDCDTDTDCDTDCDCDC
3460   DTDGDTDADGDTDCDTDCDT
3461   DTDADGDADTDTDTDADCDT
3462   DTDTDADADGDGDADGDGDT
3463   DCDADADADTDGDGDCDTDA
3464   DADCDGDTDADADTDTDADA
3465   DADADCDCDGDTDTDTDTDG
3466   DADCDTDTDADCDCDADGDT
3467   DTDADGDADTDGDGDCDTDC
3468   DCDADADTDCDGDTDGDADT
3469   DTDTDTDADADTDADTDCDC
3470   DCDGDTDTDTDGDADGDTDA
3471   DTDCDTDADGDCDCDCDGDT
3472   DADADGDTDTDCDGDTDADG
3473   DTDGDGDTDADADCDTDCDT
3474   DTDADTDTDGDGDTDGDTDA
3475   DGDADCDCDGDADADADGDG
3476   DTDCDCDTDTDADCDGDADT
3477   DTDADADTDADCDADGDADC
3478   DTDADTDCDGDCDTDTDTDG
3479   DCDTDADCDADCDGDTDADC
3480   DTDADCDTDADTDCDTDCDT
3481   DCDTDGDADCDADADADGDG
3482   DCDTDTDGDGDGDGDTDCDC
3483   DADGDCDCDGDADTDGDGDC
3484   DTDADCDADCDGDADCDCDA
3485   DTDCDGDADGDTDTDADCDG
3486   DTDCDGDADGDTDADADCDC
3487   DTDCDCDADCDTDADCDCDG
3488   DADCDCDGDADTDTDGDGDT
3489   DTDGDADCDTDTDTDADCDG
3490   DGDADTDGDGDTDTDCDADA
3491   DTDCDCDTDCDCDGDCDGDC
3492   DGDTDADTDGDADCDCDTDT
3493   DADADCDGDTDCDGDCDTDC
3494   DADGDADTDTDCDADADADC
3495   DGDADTDGDCDADCDGDTDA
3496   DGDCDGDGDADADGDADGDG
3497   DCDCDCDGDTDGDADCDCDT
3498   DCDADCDTDADCDGDGDADT
3499   DADCDTDADTDCDGDGDTDG
3500   DTDCDADADTDADADCDGDA
3501   DTDGDGDTDCDADCDTDTDG
3502   DGDADTDGDCDTDCDGDTDG
3503   DGDTDCDGDTDCDGDADADT
3504   DTDGDTDGDADADCDCDTDA
3505   DGDCDGDADADCDGDCDCDG
3506   DTDGDGDADTDGDADCDCDG
3507   DCDGDADTDGDCDTDGDTDT
3508   DCDCDGDTDTDTDGDGDTDC
3509   DADADCDTDADADADGDADC
3510   DCDADTDGDADADCDCDADG
3511   DADADCDTDCDADTDGDGDC
3512   DADADGDCDADCDGDTDADA
3513   DTDGDADADGDCDCDTDTDA
3514   DCDADGDTDTDCDCDGDTDA
3515   DADTDGDADGDGDCDTDGDA
3516   DGDADCDTDTDTDCDADGDA
3517   DADADCDCDADADGDCDGDG
3518   DADGDGDGDCDTDTDTDADA
3519   DGDADADCDGDADGDTDCDC
3520   DADGDTDADCDCDADADCDG
3521   DCDTDADCDGDADADCDADC
3522   DADADADGDCDADGDTDGDG
3523   DCDGDCDGDADTDGDADGDA
3524   DCDCDADADGDGDGDTDTDT
3525   DCDCDGDADGDADCDGDADA
3526   DGDCDCDADADGDCDGDGDT
3527   DTDCDADADGDADADTDADC
3528   DGDGDCDTDGDGDTDCDADA
3529   DTDADCDGDCDTDADCDADT
3530   DCDTDGDCDTDGDGDGDADA
3531   DCDTDCDTDGDCDTDTDCDC
3532   DGDCDTDGDCDGDCDADTDC
3533   DADADTDCDTDGDADGDGDT
3534   DADADADCDGDCDTDGDADG
3535   DADADCDTDCDTDGDCDCDA
3536   DCDADGDCDADTDCDCDGDC
3537   DTDADADCDTDCDTDGDCDT
3538   DCDADTDTDTDGDGDCDADG
3539   DADADCDADGDCDADADGDC
3540   DADGDADCDCDGDTDGDCDG
3541   DGDADADCDGDTDGDADGDG
3542   DCDADGDADCDADADGDCDT
3543   DGDGDADADADADTDTDADC
3544   DADADTDGDGDADTDTDGDG
3545   DCDTDGDGDTDGDCDADADT
3546   DTDGDADTDADADGDGDTDA
3547   DGDADTDGDGDADADCDCDA
3548   DADTDGDTDGDTDADCDTDG
3549   DGDADADADGDGDADADADT
3550   DADTDTDCDADCDGDCDTDA
3551   DADCDGDGDGDCDGDCDCDT
3552   DTDTDADCDADTDGDADCDC
3553   DADCDADADADCDGDGDTDT
3554   DTDTDGDADCDTDGDTDGDG
3555   DCDCDADGDTDADTDCDADA
3556   DCDADGDTDTDCDTDTDTDG
3557   DGDTDGDGDTDGDTDCDADC
3558   DTDADADTDCDGDTDTDADC
3559   DTDCDTDGDTDCDADTDGDG
3560   DADGDTDGDGDGDGDADGDA
3561   DTDGDADGDADADCDGDGDA
3562   DTDGDGDCDTDGDADTDGDT
3563   DADTDGDTDTDCDADADCDG
3564   DTDADGDADGDADGDTDGDG
3565   DADCDADADCDADGDCDGDA
3566   DTDADGDGDCDGDGDTDADA
3567   DCDADTDCDCDADGDTDTDA
3568   DGDTDADGDTDADADADCDG
3569   DGDADCDADGDADTDCDADT
3570   DCDADCDCDCDADADGDGDT
3571   DGDGDADGDCDCDADTDGDA
3572   DCDCDGDGDTDCDADGDCDT
3573   DADADADADTDTDGDCDADG
3574   DADADTDGDGDGDCDADTDG
3575   DTDTDCDTDTDCDADADTDT
3576   DADGDADGDTDCDCDGDCDA
3577   DTDCDCDGDADCDADADGDG
3578   DCDGDCDADCDTDADTDADT
3579   DTDCDTDADTDCDTDADADA
3580   DGDADTDGDGDTDADADCDA
3581   DGDGDADADTDADADCDTDG
3582   DGDTDADCDADTDTDGDGDT
3583   DADGDADGDGDGDTDCDADG
3584   DADTDADADCDADADCDADA
3585   DTDGDADCDTDGDTDADCDC
3586   DTDTDCDCDADCDTDCDCDT
3587   DADTDGDTDADCDADTDGDG
3588   DTDADCDGDADCDCDTDTDA
3589   DADCDADCDTDCDADADGDC
3590   DADGDGDADCDTDADTDGDC
3591   DADGDTDADGDTDTDADADC
3592   DADADADCDADCDTDTDCDC
3593   DADCDGDTDADGDGDTDCDA
3594   DGDGDCDCDGDTDTDGDTDG
3595   DGDCDCDADCDTDGDADTDG
3596   DGDTDADADTDADTDTDCDA
3597   DADGDGDTDADCDTDADADG
3598   DTDGDGDGDGDADGDGDTDA
3599   DADADTDGDGDCDTDGDGDA
3600   DTDGDCDTDTDADCDCDTDA
3601   DCDGDTDGDADCDADGDCDT
3602   DTDCDGDTDTDGDCDGDADA
3603   DGDTDCDCDADADGDGDCDG
3604   DTDGDGDADCDTDCDADGDG
3605   DTDGDTDGDGDTDCDTDGDG
3606   DTDADGDTDGDCDTDGDGDC
3607   DGDGDTDGDGDGDGDTDADA
3608   DGDTDGDTDGDADCDTDGDT
3609   DTDTDCDADCDADGDGDADT
3610   DCDTDCDCDGDCDTDTDCDC
3611   DGDCDADADTDADTDCDTDG
3612   DGDADTDTDADADGDTDGDT
3613   DGDCDCDADADCDADADCDT
3614   DCDTDTDGDGDADADCDTDT
3615   DCDTDTDCDCDGDTDADCDT
3616   DGDGDCDCDCDCDGDADTDG
3617   DGDADADTDCDTDADCDTDT
3618   DCDADTDADGDCDCDTDCDT
3619   DGDADTDGDGDTDGDGDADT
3620   DGDGDTDTDADCDGDADTDT
3621   DCDCDADADADTDADCDADC
3622   DTDCDCDADADCDGDGDTDC
3623   DTDCDGDGDADTDTDCDADA
3624   DGDADADTDADTDTDGDCDA
3625   DGDADCDADGDTDCDGDTDT
3626   DCDADGDTDADCDCDTDADA
3627   DTDGDCDADADTDCDADTDG
3628   DGDTDGDGDADGDADADCDG
3629   DADGDTDADADTDTDGDGDT
3630   DADADADTDCDADCDADADG
3631   DGDADADADGDADCDGDTDG
3632   DTDADGDTDCDCDADCDGDG
3633   DADTDGDGDADCDTDCDTDC
3634   DADADGDGDADGDGDTDADC
3635   DADADGDGDTDGDCDTDADT
3636   DCDADTDTDADGDADCDTDT
3637   DTDADADCDADADCDGDADA
3638   DTDTDGDADTDTDADADGDG
3639   DCDTDGDCDTDCDCDADADT
3640   DTDGDTDTDGDGDGDADCDG
3641   DGDGDTDGDTDADGDCDADG
3642   DADTDGDTDTDADGDTDGDC
3643   DTDCDGDADCDTDGDTDTDC
3644   DTDTDTDGDGDGDTDTDADA
3645   DGDCDCDTDTDADADCDGDA
3646   DADTDGDGDTDTDCDTDADC
3647   DGDTDTDGDCDTDGDCDTDA
3648   DTDCDGDCDCDTDADCDADC
3649   DADGDTDGDGDTDTDCDADG
3650   DADTDTDGDGDTDGDCDCDA
3651   DADGDGDTDADGDTDCDGDA
3652   DTDADADGDADTDGDADTDT
3653   DGDADCDTDGDGDADADGDA
3654   DADADGDCDCDADADTDADA
3655   DGDGDADGDTDGDADTDADT
3656   DGDTDADTDGDGDADADADA
3657   DGDGDADTDADADGDADGDC
3658   DCDTDTDADTDTDADCDADT
3659   DTDCDTDTDADGDADGDADT
3660   DGDTDTDGDGDADCDADCDT
3661   DGDCDGDADTDGDGDCDTDC
3662   DADGDCDGDTDADTDGDCDT
3663   DTDGDCDGDGDADCDCDTDT
3664   DTDCDGDGDADCDCDADTDG
3665   DADGDCDGDTDCDGDCDTDC
3666   DTDCDCDGDCDADADCDTDC
3667   DTDADTDADADTDGDCDTDA
3668   DTDTDADADCDADADADCDT
3669   DGDTDTDADGDADCDCDGDC
3670   DCDADCDADADGDTDTDCDC
3671   DADGDADTDTDGDGDTDADA
3672   DGDTDTDGDCDADGDCDCDG
3673   DGDADTDGDTDTDCDADCDA
3674   DTDCDTDTDADGDGDTDGDG
3675   DCDCDTDTDGDCDTDGDGDT
3676   DGDCDTDCDTDTDGDADADG
3677   DADGDTDADCDADADADGDA
3678   DGDADADADGDTDCDGDGDT
3679   DGDADTDADADCDGDGDTDC
3680   DTDTDADCDGDGDADTDGDA
3681   DTDGDADTDADTDTDTDADC
3682   DADCDADTDTDADCDADGDT
3683   DGDADTDADTDADCDTDCDA
3684   DADGDGDCDCDADCDTDADC
3685   DADGDADTDADGDTDGDGDT
3686   DCDTDTDTDADTDGDGDADT
3687   DGDTDCDADTDTDGDTDCDT
3688   DADTDADCDGDADGDADTDG
3689   DCDTDCDCDTDADCDGDTDG
3690   DADADADTDCDTDGDADADA
3691   DGDTDTDADADCDGDGDGDA
3692   DGDGDCDADTDTDADTDGDC
3693   DTDADGDADADTDTDTDTDT
3694   DADCDGDTDADADGDCDTDA
3695   DADTDCDCDCDTDTDGDGDG
3696   DTDTDCDTDCDGDCDTDGDG
3697   DGDADTDGDCDTDADTDTDC
3698   DGDGDGDTDTDADGDGDADT
3699   DGDGDCDADTDCDTDADGDG
3700   DGDTDCDADGDADCDTDCDA
3701   DADTDGDGDADCDGDCDTDA
3702   DADADTDGDGDADADADCDA
3703   DGDGDADGDGDTDADCDADC
3704   DADADTDGDADGDTDADCDG
3705   DTDTDADADGDADGDADGDT
3706   DTDGDADGDGDCDTDGDCDG
3707   DADADGDADGDCDADCDTDC
3708   DADADADGDADGDCDADADT
3709   DCDGDADTDGDCDGDGDTDA
3710   DTDCDTDGDCDTDADADGDT
3711   DADTDCDADADGDADADGDA
3712   DCDCDTDTDGDCDCDGDCDG
3713   DCDTDGDGDADADGDGDGDA
3714   DGDCDADCDTDGDADTDADG
3715   DGDADTDTDADTDTDTDCDT
3716   DGDADTDTDTDGDCDGDTDA
3717   DGDCDGDADCDADADTDADA
3718   DGDCDGDGDTDTDGDCDGDC
3719   DGDTDCDADGDADGDTDCDA
3720   DADADADCDTDADCDCDGDG
3721   DADADCDCDTDCDCDGDADT
3722   DGDGDTDCDADGDTDGDTDG
3723   DGDADTDTDCDGDADGDCDC
3724   DTDGDADTDGDGDTDCDGDA
3725   DGDCDCDGDADADCDTDTDG
3726   DADCDGDADCDCDGDADGDA
3727   DTDGDCDTDADADADCDGDT
3728   DADTDTDCDTDCDGDCDADG
3729   DTDGDADCDCDCDADGDADA
3730   DGDGDGDTDGDADCDGDCDA
3731   DTDGDGDADTDTDCDGDTDG
3732   DCDGDTDTDADCDADGDGDA
3733   DTDADCDTDADTDTDCDGDT
3734   DGDADADCDTDGDCDADADC
3735   DGDTDADADGDTDADGDGDA
3736   DADADTDCDADADGDTDADA
3737   DGDGDADGDGDCDADADTDG
3738   DTDGDTDCDTDADCDTDCDA
3739   DADTDCDCDADADTDCDGDT
3740   DADADTDGDCDGDCDTDCDG
3741   DTDADGDTDGDGDCDGDCDA
3742   DADCDTDGDADADADGDGDA
3743   DGDADCDTDTDCDGDTDGDG
3744   DCDGDTDTDCDCDTDADTDT
3745   DCDGDTDCDTDTDADTDGDG
3746   DADADGDGDCDGDCDTDADA
3747   DADCDCDTDADCDCDGDGDT
3748   DGDCDCDCDADCDTDADADG
3749   DTDGDTDCDADGDADTDTDG
3750   DADCDADTDGDGDCDTDADA
3751   DGDGDTDGDCDTDGDGDCDG
3752   DADADTDGDGDADGDADCDA
3753   DADCDADADGDADADGDTDT
3754   DCDADTDCDTDTDADCDADG
3755   DGDCDTDTDTDCDCDGDTDG
3756   DGDTDADTDCDGDGDTDADA
3757   DGDTDCDGDTDTDCDADTDC
3758   DADCDADTDGDTDGDCDGDT
3759   DTDCDGDTDTDGDTDGDTDG
3760   DGDTDCDCDTDTDADTDGDG
3761   DADGDADGDADCDCDCDTDC
3762   DADGDTDTDGDADADGDADT
3763   DADCDTDTDADTDCDGDTDA
3764   DTDCDADGDCDCDTDCDTDA
3765   DADGDGDADGDCDGDTDGDC
3766   DADGDADCDGDCDTDADADC
3767   DTDCDCDADTDCDTDTDTDA
3768   DTDTDADADGDADADCDADT
3769   DCDADTDTDGDADCDCDTDG
3770   DCDTDGDCDCDADTDTDCDC
3771   DTDADTDCDTDGDADGDTDT
3772   DADADADGDCDCDADADGDA
3773   DCDCDCDGDGDADCDADGDC
3774   DGDTDGDADCDTDCDGDGDT
3775   DADADTDCDADGDCDTDTDT
3776   DGDADTDGDTDADGDGDCDC
3777   DCDADGDCDCDADADTDCDC
3778   DTDGDADCDCDADCDTDCDT
3779   DCDCDTDADGDTDGDTDGDA
3780   DADADTDCDADGDTDADGDG
3781   DTDADTDCDADCDTDGDGDT
3782   DCDADGDTDTDADADCDTDG
3783   DGDTDADGDCDCDGDTDGDC
3784   DTDGDADCDADTDTDADTDC
3785   DADTDTDGDCDGDGDADTDG
3786   DADCDGDTDTDGDADGDADT
3787   DTDCDCDGDTDCDTDADADC
3788   DADGDCDGDCDADADCDTDA
3789   DTDGDGDGDTDGDCDCDCDG
3790   DTDGDADGDADADGDCDTDA
3791   DTDGDGDADCDTDCDTDGDG
3792   DTDTDCDADGDGDADGDTDT
3793   DCDGDCDTDGDCDGDTDTDA
3794   DCDTDTDADADADCDCDGDC
3795   DTDGDCDCDTDTDCDCDTDC
3796   DTDCDGDCDGDTDTDADTDC
3797   DTDADCDCDTDTDGDGDTDA
3798   DCDADCDCDTDCDADGDADC
3799   DADGDADGDADTDGDADCDT
3800   DCDTDCDTDADTDADADGDG
3801   DADADCDTDTDGDADGDGDA
3802   DTDADADCDCDGDTDGDGDG
3803   DTDADCDADCDADADCDCDA
3804   DTDTDADTDCDTDGDGDCDC
3805   DTDGDCDTDCDTDGDTDADC
3806   DCDCDADADGDGDADCDADC
3807   DGDTDGDADADGDADGDADA
3808   DCDCDTDCDTDADTDTDADC
3809   DTDCDADCDADGDCDGDTDC
3810   DTDTDGDCDTDCDCDTDADT
3811   DGDTDTDADCDGDCDGDCDT
3812   DGDADGDTDADCDGDADTDG
3813   DADGDADADCDCDCDTDGDA
3814   DGDGDCDADCDTDTDGDCDT
3815   DGDGDGDADCDTDCDCDADA
3816   DCDADGDADCDCDCDADGDT
3817   DGDCDGDCDTDTDTDGDADC
3818   DCDGDTDGDADTDGDADCDC
3819   DTDGDCDGDCDGDADGDCDG
3820   DTDGDADGDTDTDGDGDADA
3821   DTDADCDGDGDTDADADGDG
3822   DCDTDGDGDCDTDTDTDADC
3823   DGDCDTDADCDADGDTDTDC
3824   DADTDGDCDTDTDADADCDC
3825   DCDTDADADCDCDTDTDADG
3826   DTDGDADTDGDCDCDGDADG
3827   DADADGDTDADCDCDCDGDC
3828   DTDGDADGDGDCDTDTDCDG
3829   DTDGDADCDGDCDTDADTDC
3830   DGDTDADGDCDGDGDCDCDT
3831   DTDADGDADCDTDTDADGDA
3832   DGDADADGDGDCDCDCDCDA
3833   DADTDGDCDADTDTDADCDC
3834   DADGDTDGDGDCDTDTDCDC
3835   DGDADADCDCDGDTDCDADG
3836   DADADCDADTDCDADTDTDG
3837   DADGDGDADCDCDTDTDCDC
3838   DTDADADCDGDTDTDGDGDC
3839   DCDTDTDADADGDGDGDTDG
3840   DADTDGDADCDCDTDGDCDA
3841   DTDADCDGDTDADCDCDADC
3842   DGDADTDTDGDTDTDCDCDA
3843   DADCDADADCDTDCDADGDG
3844   DTDCDADGDTDADCDCDADA
3845   DCDADGDADADGDADTDTDC
3846   DTDGDGDTDCDADTDTDGDA
3847   DCDCDCDTDADGDTDGDGDT
3848   DCDGDCDGDGDTDADADGDG
3849   DADCDGDADADADCDADGDG
3850   DTDTDADCDGDCDTDGDTDG
3851   DCDTDGDTDADCDADCDADC
3852   DTDGDADADCDGDGDTDTDA
3853   DCDADTDCDTDADCDCDTDT
3854   DADTDGDGDADADGDCDTDG
3855   DGDADGDGDTDTDTDCDCDG
3856   DTDGDADTDGDGDCDTDADC
3857   DTDCDCDGDADTDADADGDA
3858   DCDCDCDTDTDGDADGDTDT
3859   DADCDTDCDGDCDTDADADG
3860   DADADGDGDCDADADADGDC
3861   DADADTDGDGDGDGDADGDT
3862   DCDCDADGDADCDGDGDTDT
3863   DGDTDCDTDADCDGDADGDA
3864   DGDTDADADCDTDTDCDGDG
3865   DTDGDADCDGDGDTDADTDG
3866   DTDTDCDGDGDTDADADGDG
3867   DTDADTDTDCDADGDTDCDC
3868   DTDADTDCDCDTDTDCDTDT
3869   DADADADCDADCDCDADCDA
3870   DADCDTDGDTDGDCDGDADT
3871   DGDGDADADGDADGDADTDT
3872   DCDGDTDGDCDCDCDGDTDG
3873   DGDTDADTDGDADADADGDA
3874   DGDADTDGDCDGDTDADTDT
3875   DTDGDCDGDADTDADCDCDC
3876   DTDTDGDADGDCDCDADGDT
3877   DCDADTDGDCDADGDADCDT
3878   DCDADCDCDGDCDCDTDTDG
3879   DTDADADTDTDCDGDTDGDA
3880   DTDGDADGDGDTDCDADTDT
3881   DADGDGDGDCDCDGDADCDT
3882   DADCDCDADGDTDCDCDGDC
3883   DTDCDGDTDGDADCDGDTDA
3884   DGDADCDGDGDTDADADGDC
3885   DADTDGDADCDGDTDTDADA
3886   DGDTDADCDTDCDGDTDTDG
3887   DTDTDCDTDADCDCDADGDA
3888   DTDGDADCDCDCDGDTDADT
3889   DCDADCDTDCDGDTDGDADG
3890   DADADADGDGDCDGDCDTDC
3891   DTDGDGDCDTDCDADTDGDA
3892   DTDGDADCDCDGDADTDTDG
3893   DGDADTDGDCDCDCDTDTDG
3894   DCDGDTDTDADGDGDCDADT
3895   DTDGDADGDTDADTDCDTDC
3896   DCDGDTDGDADGDTDCDCDA
3897   DTDGDCDADGDTDTDGDGDA
3898   DTDTDCDCDGDTDTDADADG
3899   DGDTDCDGDADGDGDGDTDG
3900   DADADGDTDADCDTDTDGDC
3901   DTDGDADCDTDTDCDCDTDT
3902   DGDADGDGDADADCDADCDA
3903   DTDGDADTDGDCDGDTDCDC
3904   DTDADCDGDGDTDTDGDCDT
3905   DGDCDTDADCDGDCDADTDA
3906   DTDCDADTDTDGDADGDADT
3907   DGDTDCDTDGDTDGDGDGDA
3908   DGDGDADGDTDTDGDADTDG
3909   DTDGDTDADCDTDCDTDGDA
3910   DGDGDADCDGDADTDGDADG
3911   DGDGDTDTDADCDGDGDTDA
3912   DCDGDTDCDTDTDTDCDADT
3913   DTDGDADGDTDGDGDTDGDA
3914   DTDTDTDADTDGDCDADTDT
3915   DADGDGDADCDTDGDCDADT
3916   DADGDGDGDADTDGDCDADC
3917   DTDADTDADGDADCDCDADC
3918   DGDGDADTDGDGDTDCDADG
3919   DTDTDCDTDTDTDADADGDT
3920   DTDADCDTDGDADADADADG
3921   DADCDADCDGDADTDADADA
3922   DTDTDADADTDADCDGDADC
3923   DTDCDADCDTDADTDADGDG
3924   DGDADGDADGDGDADGDGDG
3925   DADCDGDADADADGDGDTDT
3926   DADCDTDADTDADTDADGDA
3927   DTDADCDTDGDADADTDGDA
3928   DADTDADCDTDTDADTDADG
3929   DADGDTDGDCDADTDADADA
3930   DGDTDADTDGDCDADTDADA
3931   DTDGDGDTDGDTDADCDCDT
3932   DADGDADGDTDGDADCDCDT
3933   DCDTDADADGDADADTDGDG
3934   DTDGDADTDTDADTDADTDT
3935   DGDTDADTDTDADGDTDADT
3936   DCDADCDCDTDTDADADCDT
3937   DTDADADGDGDADCDCDADA
3938   DCDADTDADADADGDGDGDA
3939   DGDGDADGDADCDTDCDADT
3940   DGDTDTDCDCDGDCDTDTDA
3941   DTDTDGDTDTDGDADADCDC
3942   DTDADCDTDGDCDGDGDCDA
3943   DTDADGDADGDTDCDADCDC
3944   DTDADCDCDGDADTDTDTDC
3945   DTDTDGDTDGDGDTDADCDT
3946   DTDTDGDTDGDCDTDGDCDC
3947   DCDTDTDGDGDGDTDADCDG
3948   DCDADTDCDTDCDTDTDADC
3949   DTDGDGDADGDADCDCDTDC
3950   DADGDTDTDCDADCDTDGDG
3951   DADGDTDCDTDGDTDCDGDT
3952   DTDTDGDCDTDCDTDADTDA
3953   DCDTDCDADCDTDTDGDTDA
3954   DGDCDGDADTDTDADGDGDG
3955   DTDCDTDTDCDCDTDGDADC
3956   DCDGDADCDTDGDADTDGDG
3957   DCDTDCDADCDCDGDADGDG
3958   DGDADTDTDCDADGDCDGDG
3959   DTDADTDGDADTDTDGDCDA
3960   DTDCDADCDADCDCDADCDT
3961   DTDCDADTDCDCDCDTDADT
3962   DADGDADGDTDCDADADGDT
3963   DCDCDTDADADGDGDTDADT
3964   DADCDCDCDADTDADADADG
3965   DADGDCDCDTDCDTDADADT
3966   DGDGDTDCDTDADTDCDCDT
3967   DADADGDGDTDCDTDADTDA
3968   DCDCDTDADADADGDADTDA
3969   DGDGDCDCDADTDCDCDTDA
3970   DTDCDADGDTDGDTDCDADC
3971   DCDTDADADADGDADGDGDG
3972   DTDCDTDTDADGDADGDADG
3973   DGDGDCDCDTDADTDGDGDA
3974   DGDTDTDCDCDTDADTDADG
3975   DGDGDTDCDCDTDTDTDADA
3976   DADADTDADTDADCDCDADT
3977   DADADADADADTDCDTDGDA
3978   DGDTDGDADCDTDADTDCDT
3979   DCDADCDADGDTDGDTDADC
3980   DGDGDADCDCDTDADADADG
3981   DTDTDCDCDCDCDCDADTDA
3982   DGDGDGDGDGDTDADCDCDT
3983   DADADADGDCDCDCDADGDC
3984   DCDADADTDCDADCDCDTDA
3985   DADADGDTDCDADADCDCDT
3986   DTDCDGDGDTDTDGDADCDC
3987   DTDTDGDADGDGDGDTDTDC
3988   DCDCDTDADADGDGDGDTDT
3989   DGDGDGDGDADTDGDADCDC
3990   DCDTDTDGDGDGDTDTDTDG
3991   DTDCDTDTDTDGDGDGDTDG
3992   DTDTDADCDCDTDTDGDADG
3993   DTDGDTDCDTDCDTDCDTDG
3994   DTDGDTDCDCDCDT

Samples:

sample_1: bacteriophage T7, [U-99% 13C; U-99% 15N], 5 mg

sample_conditions_1: ionic strength: 10 mM; pH: 8; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 13C-13C DARRsample_1solidsample_conditions_1
2D 15N-13C TEDORsample_1solidsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

    Related Database Links: