BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19747

Title: 13C and 15N Chemical Shift Assignments for the M13 Bacteriophage   PubMed: 22085310

Authors: Morag, Omry; Goldbourt, Amir

Citation: Morag, Omry; Abramov, Gili; Goldbourt, Amir. "Similarities and differences within members of the Ff family of filamentous bacteriophage viruses."  J Phys Chem B 115, 15370-15379 (2011).

Assembly members:
M13_bacteriophage, polymer, 50 residues, 22000000 Da.
ssDNA, polymer, 8669 residues, Formula weight is not available

Natural source:   Common Name: M13 Bacteriophage   Taxonomy ID: 38018   Superkingdom: Virus   Kingdom: not available   Genus/species: not available M13 Bacteriophage

Experimental source:   Production method: purified from the natural source   Host organism: Escherichia coli

Entity Sequences (FASTA):
M13_bacteriophage: AEGDDPAKAAFNSLQASATE YIGYAWAMVVVIVGATIGIK LFKKFTSKAS
ssDNA: AACGCTACTACTATTAGTAG AATTGATGCCACCTTTTCAG CTCGCGCCCCAAATGAAAAT ATAGCTAAACAGGTTATTGA CCATTTGCGAAATGTATCTA ATGGTCAAACTAAATCTACT CGTTCGCAGAATTGGGAATC AACTGTTACATGGAATGAAA CTTCCAGACACCGTACTTTA GTTGCATATTTAAAACATGT TGAGCTACAGCACCAGATTC AGCAATTAAGCTCTAAGCCA TCCGCAAAAATGACCTCTTA TCAAAAGGAGCAATTAAAGG TACTCTCTAATCCTGACCTG TTGGAGTTTGCTTCCGGTCT GGTTCGCTTTGAAGCTCGAA TTAAAACGCGATATTTGAAG TCTTTCGGGCTTCCTCTTAA TCTTTTTGATGCAATCCGCT TTGCTTCTGACTATAATAGT CAGGGTAAAGACCTGATTTT TGATTTATGGTCATTCTCGT TTTCTGAACTGTTTAAAGCA TTTGAGGGGGATTCAATGAA TATTTATGACGATTCCGCAG TATTGGACGCTATCCAGTCT AAACATTTTACTATTACCCC CTCTGGCAAAACTTCTTTTG CAAAAGCCTCTCGCTATTTT GGTTTTTATCGTCGTCTGGT AAACGAGGGTTATGATAGTG TTGCTCTTACTATGCCTCGT AATTCCTTTTGGCGTTATGT ATCTGCATTAGTTGAATGTG GTATTCCTAAATCTCAACTG ATGAATCTTTCTACCTGTAA TAATGTTGTTCCGTTAGTTC GTTTTATTAACGTAGATTTT TCTTCCCAACGTCCTGACTG GTATAATGAGCCAGTTCTTA AAATCGCATAAGGTAATTCA CAATGATTAAAGTTGAAATT AAACCATCTCAAGCCCAATT TACTACTCGTTCTGGTGTTT CTCGTCAGGGCAAGCCTTAT TCACTGAATGAGCAGCTTTG TTACGTTGATTTGGGTAATG AATATCCGGTTCTTGTCAAG ATTACTCTTGATGAAGGTCA GCCAGCCTATGCGCCTGGTC TGTACACCGTTCATCTGTCC TCTTTCAAAGTTGGTCAGTT CGGTTCCCTTATGATTGACC GTCTGCGCCTCGTTCCGGCT AAGTAACATGGAGCAGGTCG CGGATTTCGACACAATTTAT CAGGCGATGATACAAATCTC CGTTGTACTTTGTTTCGCGC TTGGTATAATCGCTGGGGGT CAAAGATGAGTGTTTTAGTG TATTCTTTCGCCTCTTTCGT TTTAGGTTGGTGCCTTCGTA GTGGCATTACGTATTTTACC CGTTTAATGGAAACTTCCTC ATGAAAAAGTCTTTAGTCCT CAAAGCCTCTGTAGCCGTTG CTACCCTCGTTCCGATGCTG TCTTTCGCTGCTGAGGGTGA CGATCCCGCAAAAGCGGCCT TTAACTCCCTGCAAGCCTCA GCGACCGAATATATCGGTTA TGCGTGGGCGATGGTTGTTG TCATTGTCGGCGCAACTATC GGTATCAAGCTGTTTAAGAA ATTCACCTCGAAAGCAAGCT GATAAACCGATACAATTAAA GGCTCCTTTTGGAGCCTTTT TTTTTGGAGATTTTCAACGT GAAAAAATTATTATTCGCAA TTCCTTTAGTTGTTCCTTTC TATTCTCACTCCGCTGAAAC TGTTGAAAGTTGTTTAGCAA AACCCCATACAGAAAATTCA TTTACTAACGTCTGGAAAGA CGACAAAACTTTAGATCGTT ACGCTAACTATGAGGGTTGT CTGTGGAATGCTACAGGCGT TGTAGTTTGTACTGGTGACG AAACTCAGTGTTACGGTACA TGGGTTCCTATTGGGCTTGC TATCCCTGAAAATGAGGGTG GTGGCTCTGAGGGTGGCGGT TCTGAGGGTGGCGGTTCTGA GGGTGGCGGTACTAAACCTC CTGAGTACGGTGATACACCT ATTCCGGGCTATACTTATAT CAACCCTCTCGACGGCACTT ATCCGCCTGGTACTGAGCAA AACCCCGCTAATCCTAATCC TTCTCTTGAGGAGTCTCAGC CTCTTAATACTTTCATGTTT CAGAATAATAGGTTCCGAAA TAGGCAGGGGGCATTAACTG TTTATACGGGCACTGTTACT CAAGGCACTGACCCCGTTAA AACTTATTACCAGTACACTC CTGTATCATCAAAAGCCATG TATGACGCTTACTGGAACGG TAAATTCAGAGACTGCGCTT TCCATTCTGGCTTTAATGAG GATCCATTCGTTTGTGAATA TCAAGGCCAATCGTCTGACC TGCCTCAACCTCCTGTCAAT GCTGGCGGCGGCTCTGGTGG TGGTTCTGGTGGCGGCTCTG AGGGTGGTGGCTCTGAGGGT GGCGGTTCTGAGGGTGGCGG CTCTGAGGGAGGCGGTTCCG GTGGTGGCTCTGGTTCCGGT GATTTTGATTATGAAAAGAT GGCAAACGCTAATAAGGGGG CTATGACCGAAAATGCCGAT GAAAACGCGCTACAGTCTGA CGCTAAAGGCAAACTTGATT CTGTCGCTACTGATTACGGT GCTGCTATCGATGGTTTCAT TGGTGACGTTTCCGGCCTTG CTAATGGTAATGGTGCTACT GGTGATTTTGCTGGCTCTAA TTCCCAAATGGCTCAAGTCG GTGACGGTGATAATTCACCT TTAATGAATAATTTCCGTCA ATATTTACCTTCCCTCCCTC AATCGGTTGAATGTCGCCCT TTTGTCTTTAGCGCTGGTAA ACCATATGAATTTTCTATTG ATTGTGACAAAATAAACTTA TTCCGTGGTGTCTTTGCGTT TCTTTTATATGTTGCCACCT TTATGTATGTATTTTCTACG TTTGCTAACATACTGCGTAA TAAGGAGTCTTAATCATGCC AGTTCTTTTGGGTATTCCGT TATTATTGCGTTTCCTCGGT TTCCTTCTGGTAACTTTGTT CGGCTATCTGCTTACTTTTC TTAAAAAGGGCTTCGGTAAG ATAGCTATTGCTATTTCATT GTTTCTTGCTCTTATTATTG GGCTTAACTCAATTCTTGTG GGTTATCTCTCTGATATTAG CGCTCAATTACCCTCTGACT TTGTTCAGGGTGTTCAGTTA ATTCTCCCGTCTAATGCGCT TCCCTGTTTTTATGTTATTC TCTCTGTAAAGGCTGCTATT TTCATTTTTGACGTTAAACA AAAAATCGTTTCTTATTTGG ATTGGGATAAATAATATGGC TGTTTATTTTGTAACTGGCA AATTAGGCTCTGGAAAGACG CTCGTTAGCGTTGGTAAGAT TCAGGATAAAATTGTAGCTG GGTGCAAAATAGCAACTAAT CTTGATTTAAGGCTTCAAAA CCTCCCGCAAGTCGGGAGGT TCGCTAAAACGCCTCGCGTT CTTAGAATACCGGATAAGCC TTCTATATCTGATTTGCTTG CTATTGGGCGCGGTAATGAT TCCTACGATGAAAATAAAAA CGGCTTGCTTGTTCTCGATG AGTGCGGTACTTGGTTTAAT ACCCGTTCTTGGAATGATAA GGAAAGACAGCCGATTATTG ATTGGTTTCTACATGCTCGT AAATTAGGATGGGATATTAT TTTTCTTGTTCAGGACTTAT CTATTGTTGATAAACAGGCG CGTTCTGCATTAGCTGAACA TGTTGTTTATTGTCGTCGTC TGGACAGAATTACTTTACCT TTTGTCGGTACTTTATATTC TCTTATTACTGGCTCGAAAA TGCCTCTGCCTAAATTACAT GTTGGCGTTGTTAAATATGG CGATTCTCAATTAAGCCCTA CTGTTGAGCGTTGGCTTTAT ACTGGTAAGAATTTGTATAA CGCATATGATACTAAACAGG CTTTTTCTAGTAATTATGAT TCCGGTGTTTATTCTTATTT AACGCCTTATTTATCACACG GTCGGTATTTCAAACCATTA AATTTAGGTCAGAAGATGAA ATTAACTAAAATATATTTGA AAAAGTTTTCTCGCGTTCTT TGTCTTGCGATTGGATTTGC ATCAGCATTTACATATAGTT ATATAACCCAACCTAAGCCG GAGGTTAAAAAGGTAGTCTC TCAGACCTATGATTTTGATA AATTCACTATTGACTCTTCT CAGCGTCTTAATCTAAGCTA TCGCTATGTTTTCAAGGATT CTAAGGGAAAATTAATTAAT AGCGACGATTTACAGAAGCA AGGTTATTCACTCACATATA TTGATTTATGTACTGTTTCC ATTAAAAAAGGTAATTCAAA TGAAATTGTTAAATGTAATT AATTTTGTTTTCTTGATGTT TGTTTCATCATCTTCTTTTG CTCAGGTAATTGAAATGAAT AATTCGCCTCTGCGCGATTT TGTAACTTGGTATTCAAAGC AATCAGGCGAATCCGTTATT GTTTCTCCCGATGTAAAAGG TACTGTTACTGTATATTCAT CTGACGTTAAACCTGAAAAT CTACGCAATTTCTTTATTTC TGTTTTACGTGCTAATAATT TTGATATGGTTGGTTCAATT CCTTCCATAATTCAGAAGTA TAATCCAAACAATCAGGATT ATATTGATGAATTGCCATCA TCTGATAATCAGGAATATGA TGATAATTCCGCTCCTTCTG GTGGTTTCTTTGTTCCGCAA AATGATAATGTTACTCAAAC TTTTAAAATTAATAACGTTC GGGCAAAGGATTTAATACGA GTTGTCGAATTGTTTGTAAA GTCTAATACTTCTAAATCCT CAAATGTATTATCTATTGAC GGCTCTAATCTATTAGTTGT TAGTGCACCTAAAGATATTT TAGATAACCTTCCTCAATTC CTTTCTACTGTTGATTTGCC AACTGACCAGATATTGATTG AGGGTTTGATATTTGAGGTT CAGCAAGGTGATGCTTTAGA TTTTTCATTTGCTGCTGGCT CTCAGCGTGGCACTGTTGCA GGCGGTGTTAATACTGACCG CCTCACCTCTGTTTTATCTT CTGCTGGTGGTTCGTTCGGT ATTTTTAATGGCGATGTTTT AGGGCTATCAGTTCGCGCAT TAAAGACTAATAGCCATTCA AAAATATTGTCTGTGCCACG TATTCTTACGCTTTCAGGTC AGAAGGGTTCTATCTCTGTT GGCCAGAATGTCCCTTTTAT TACTGGTCGTGTGACTGGTG AATCTGCCAATGTAAATAAT CCATTTCAGACGATTGAGCG TCAAAATGTAGGTATTTCCA TGAGCGTTTTTCCTGTTGCA ATGGCTGGCGGTAATATTGT TCTGGATATTACCAGCAAGG CCGATAGTTTGAGTTCTTCT ACTCAGGCAAGTGATGTTAT TACTAATCAAAGAAGTATTG CTACAACGGTTAATTTGCGT GATGGACAGACTCTTTTACT CGGTGGCCTCACTGATTATA AAAACACTTCTCAAGATTCT GGCGTACCGTTCCTGTCTAA AATCCCTTTAATCGGCCTCC TGTTTAGCTCCCGCTCTGAT TCCAACGAGGAAAGCACGTT ATACGTGCTCGTCAAAGCAA CCATAGTACGCGCCCTGTAG CGGCGCATTAAGCGCGGCGG GTGTGGTGGTTACGCGCAGC GTGACCGCTACACTTGCCAG CGCCCTAGCGCCCGCTCCTT TCGCTTTCTTCCCTTCCTTT CTCGCCACGTTCGCCGGCTT TCCCCGTCAAGCTCTAAATC GGGGGCTCCCTTTAGGGTTC CGATTTAGTGCTTTACGGCA CCTCGACCCCAAAAAACTTG ATTTGGGTGATGGTTCACGT AGTGGGCCATCGCCCTGATA GACGGTTTTTCGCCCTTTGA CGTTGGAGTCCACGTTCTTT AATAGTGGACTCTTGTTCCA AACTGGAACAACACTCAACC CTATCTCGGGACGGATCGCT TCATGTGGCAGGAGAAAAAA GGCTGCACCGGTGCGTCAGC AGAATATGTGATACAGGATA TATTCCGCTTCCTCGCTCAC TGACTCGCTACGCTCGGTCG TTCGACTGCGGCGAGCGGAA ATGGCTTACGAACGGGGCGG AGATTTCCTGGAAGATGCCA GGAAGATACTTAACAGGGAA GTGAGAGGGCCGCGGCAAAG CCGTTTTTCCATAGGCTCCG CCCCCCTGACAAGCATCACG AAATCTGACGCTCAAATCAG TGGTGGCGAAACCCGACAGG ACTATAAAGATACCAGGCGT TTCCCCCTGGCGGCTCCCTC GTGCGCTCTCCTGTTCCTGC CTTTCGGTTTACCGGTGTCA TTCCGCTGTTATGGCCGCGT TTGTCTCATTCCACGCCTGA CACTCAGTTCCGGGTAGGCA GTTCGCTCCAAGCTGGACTG TATGCACGAACCCCCCGTTC AGTCCGACCGCTGCGCCTTA TCCGGTAACTATCGTCTTGA GTCCAACCCGGAAAGACATG CAAAAGCACCACTGGCAGCA GCCACTGGTAATTGATTTAG AGGAGTTAGTCTTGAAGTCA TGCGCCGGTTAAGGCTAAAC TGAAAGGACAAGTTTTGGTG ACTGCGCTCCTCCAAGCCAG TTACCTCGGTTCAAAGAGTT GGTAGCTCAGAGAACCTTCG AAAAACCGCCCTGCAAGGCG GTTTTTTCGTTTTCAGAGCA AGAGATTACGCGCAGACCAA AACGATCTCAAGAAGATCAT CTTATTAAGGGGTCTGACGC TCAGTGGAACGAAAACTCAC GTTAAGGGATTTTGGTCATG AGATTATCAAAAAGGATCTT CACCTAGATCCTTTTAAATT AAAAATGAAGTTTTAAATCA ATCTAAAGTATATATGAGTA AACTTGGTCTGACAGTTACC AATGCTTAATCAGTGAGGCA CCTATCTCAGCGATCTGTCT ATTTCGTTCATCCATAGTTG CCTGACTCCCCGTCGTGTAG ATAACTACGATACGGGAGGG CTTACCATCTGGCCCCAGTG CTGCAATGATACCGCGAGAC CCACGCTCACCGGCTCCAGA TTTATCAGCAATAAACCAGC CAGCCGATTCGAGCTCGCCC CGGGGATCGACCAGTTGGTG ATTTTGAACTTTTGCTTTGC CACGGAACGGTCTGCGTTGT CGGGAAGATGCGTGATCTGA TCCTTCAACTCAGCAAAAGT TCGATTTATTCAACAAAGCC GCCGTCCCGTCAAGTCAGCG TAATGCTCTGCCAGTGTTAC AACCAATTAACCAATTCTGA TTAGAAAAACTCATCGAGCA TCAAATGAAACTGCAATTTA TTCATATCAGGATTATCAAT ACCATATTTTTGAAAAAGCC GTTTCTGTAATGAAGGAGAA AACTCACCGAGGCAGTTCCA TAGGATGGCAAGATCCTGGT ATCGGTCTGCGATTCCGACT CGTCCAACATCAATACAACC TATTAATTTCCCCTCGTCAA AAATAAGGTTATCAAGTGAG AAATCACCATGAGTGACGAC TGAATCCGGTGAGAATGGCA AAAGCTTATGCATTTCTTTC CAGACTTGTTCAACAGGCCA GCCATTACGCTCGTCATCAA AATCACTCGCATCAACCAAA CCGTTATTCATTCGTGATTG CGCCTGAGCGAGACGAAATA CGCGATCGCTGTTAAAAGGA CAATTACAAACAGGAATCGA ATGCAACCGGCGCAGGAACA CTGCCAGCGCATCAACAATA TTTTCACCTGAATCAGGATA TTCTTCTAATACCTGGAATG CTGTTTTCCCGGGGATCGCA GTGGTGAGTAACCATGCATC ATCAGGAGTACGGATAAAAT GCTTGATGGTCGGAAGAGGC ATAAATTCCGTCAGCCAGTT TAGTCTGACCATCTCATCTG TAACATCATTGGCAACGCTA CCTTTGCCATGTTTCAGAAA CAACTCTGGCGCATCGGGCT TCCCATACAATCGATAGATT GTCGCACCTGATTGCCCGAC ATTATCGCGAGCCCATTTAT ACCCATATAAATCAGCATCC ATGTTGGAATTTAATCGCGG CCTCGAGCAAGACGTTTCCC GTTGAATATGGCTCATAACA CCCCTTGTATTACTGTTTAT GTAAGCAGACAGTTTTATTG TTCATGATGATATATTTTTA TCTTGTGCAATGTAACATCA GAGATTTTGAGACACAACGT GGCTTTCCCCCCCCCCCCCT GCAGGTCTCGGGCTATTCTT TTGATTTATAAGGGATTTTG CCGATTTCGGCCTATTGGTT AAAAAATGAGCTGATTTAAC AAAAATTTAACGCGAATTTT AACAAAATATTAACGTTTAC AATTTAAATATTTGCTTATA CAATCTTCCTGTTTTTGGGG CTTTTCTGATTATCAACCGG GGTACATATGATTGACATGC TAGTTTTACGATTACCGTTC ATCGATTCTCTTGTTTGCTC CAGACTCTCAGGCAATGACC TGATAGCCTTTGTAGACCTC TCAAAAATAGCTACCCTCTC CGGCATGAATTTATCAGCTA GAACGGTTGAATATCATATT GATGGTGATTTGACTGTCTC CGGCCTTTCTCACCCTTTTG AATCTTTACCTACACATTAC TCAGGCATTGCATTTAAAAT ATATGAGGGTTCTAAAAATT TTTATCCTTGCGTTGAAATA AAGGCTTCTCCCGCAAAAGT ATTACAGGGTCATAATGTTT TTGGTACAACCGATTTAGCT TTATGCTCTGAGGCTTTATT GCTTAATTTTGCTAATTCTT TGCCTTGCCTGTATGATTTA TTGGATGTT

Data sets:
Data typeCount
13C chemical shifts238
15N chemical shifts53

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1capsid1
2ssDNA2

Entities:

Entity 1, capsid 50 residues - 22000000 Da.

1   ALAGLUGLYASPASPPROALALYSALAALA
2   PHEASNSERLEUGLNALASERALATHRGLU
3   TYRILEGLYTYRALATRPALAMETVALVAL
4   VALILEVALGLYALATHRILEGLYILELYS
5   LEUPHELYSLYSPHETHRSERLYSALASER

Entity 2, ssDNA 8669 residues - Formula weight is not available

1   DADADCDGDCDTDADCDTDA
2   DCDTDADTDTDADGDTDADG
3   DADADTDTDGDADTDGDCDC
4   DADCDCDTDTDTDTDCDADG
5   DCDTDCDGDCDGDCDCDCDC
6   DADADADTDGDADADADADT
7   DADTDADGDCDTDADADADC
8   DADGDGDTDTDADTDTDGDA
9   DCDCDADTDTDTDGDCDGDA
10   DADADTDGDTDADTDCDTDA
11   DADTDGDGDTDCDADADADC
12   DTDADADADTDCDTDADCDT
13   DCDGDTDTDCDGDCDADGDA
14   DADTDTDGDGDGDADADTDC
15   DADADCDTDGDTDTDADCDA
16   DTDGDGDADADTDGDADADA
17   DCDTDTDCDCDADGDADCDA
18   DCDCDGDTDADCDTDTDTDA
19   DGDTDTDGDCDADTDADTDT
20   DTDADADADADCDADTDGDT
21   DTDGDADGDCDTDADCDADG
22   DCDADCDCDADGDADTDTDC
23   DADGDCDADADTDTDADADG
24   DCDTDCDTDADADGDCDCDA
25   DTDCDCDGDCDADADADADA
26   DTDGDADCDCDTDCDTDTDA
27   DTDCDADADADADGDGDADG
28   DCDADADTDTDADADADGDG
29   DTDADCDTDCDTDCDTDADA
30   DTDCDCDTDGDADCDCDTDG
31   DTDTDGDGDADGDTDTDTDG
32   DCDTDTDCDCDGDGDTDCDT
33   DGDGDTDTDCDGDCDTDTDT
34   DGDADADGDCDTDCDGDADA
35   DTDTDADADADADCDGDCDG
36   DADTDADTDTDTDGDADADG
37   DTDCDTDTDTDCDGDGDGDC
38   DTDTDCDCDTDCDTDTDADA
39   DTDCDTDTDTDTDTDGDADT
40   DGDCDADADTDCDCDGDCDT
41   DTDTDGDCDTDTDCDTDGDA
42   DCDTDADTDADADTDADGDT
43   DCDADGDGDGDTDADADADG
44   DADCDCDTDGDADTDTDTDT
45   DTDGDADTDTDTDADTDGDG
46   DTDCDADTDTDCDTDCDGDT
47   DTDTDTDCDTDGDADADCDT
48   DGDTDTDTDADADADGDCDA
49   DTDTDTDGDADGDGDGDGDG
50   DADTDTDCDADADTDGDADA
51   DTDADTDTDTDADTDGDADC
52   DGDADTDTDCDCDGDCDADG
53   DTDADTDTDGDGDADCDGDC
54   DTDADTDCDCDADGDTDCDT
55   DADADADCDADTDTDTDTDA
56   DCDTDADTDTDADCDCDCDC
57   DCDTDCDTDGDGDCDADADA
58   DADCDTDTDCDTDTDTDTDG
59   DCDADADADADGDCDCDTDC
60   DTDCDGDCDTDADTDTDTDT
61   DGDGDTDTDTDTDTDADTDC
62   DGDTDCDGDTDCDTDGDGDT
63   DADADADCDGDADGDGDGDT
64   DTDADTDGDADTDADGDTDG
65   DTDTDGDCDTDCDTDTDADC
66   DTDADTDGDCDCDTDCDGDT
67   DADADTDTDCDCDTDTDTDT
68   DGDGDCDGDTDTDADTDGDT
69   DADTDCDTDGDCDADTDTDA
70   DGDTDTDGDADADTDGDTDG
71   DGDTDADTDTDCDCDTDADA
72   DADTDCDTDCDADADCDTDG
73   DADTDGDADADTDCDTDTDT
74   DCDTDADCDCDTDGDTDADA
75   DTDADADTDGDTDTDGDTDT
76   DCDCDGDTDTDADGDTDTDC
77   DGDTDTDTDTDADTDTDADA
78   DCDGDTDADGDADTDTDTDT
79   DTDCDTDTDCDCDCDADADC
80   DGDTDCDCDTDGDADCDTDG
81   DGDTDADTDADADTDGDADG
82   DCDCDADGDTDTDCDTDTDA
83   DADADADTDCDGDCDADTDA
84   DADGDGDTDADADTDTDCDA
85   DCDADADTDGDADTDTDADA
86   DADGDTDTDGDADADADTDT
87   DADADADCDCDADTDCDTDC
88   DADADGDCDCDCDADADTDT
89   DTDADCDTDADCDTDCDGDT
90   DTDCDTDGDGDTDGDTDTDT
91   DCDTDCDGDTDCDADGDGDG
92   DCDADADGDCDCDTDTDADT
93   DTDCDADCDTDGDADADTDG
94   DADGDCDADGDCDTDTDTDG
95   DTDTDADCDGDTDTDGDADT
96   DTDTDGDGDGDTDADADTDG
97   DADADTDADTDCDCDGDGDT
98   DTDCDTDTDGDTDCDADADG
99   DADTDTDADCDTDCDTDTDG
100   DADTDGDADADGDGDTDCDA
101   DGDCDCDADGDCDCDTDADT
102   DGDCDGDCDCDTDGDGDTDC
103   DTDGDTDADCDADCDCDGDT
104   DTDCDADTDCDTDGDTDCDC
105   DTDCDTDTDTDCDADADADG
106   DTDTDGDGDTDCDADGDTDT
107   DCDGDGDTDTDCDCDCDTDT
108   DADTDGDADTDTDGDADCDC
109   DGDTDCDTDGDCDGDCDCDT
110   DCDGDTDTDCDCDGDGDCDT
111   DADADGDTDADADCDADTDG
112   DGDADGDCDADGDGDTDCDG
113   DCDGDGDADTDTDTDCDGDA
114   DCDADCDADADTDTDTDADT
115   DCDADGDGDCDGDADTDGDA
116   DTDADCDADADADTDCDTDC
117   DCDGDTDTDGDTDADCDTDT
118   DTDGDTDTDTDCDGDCDGDC
119   DTDTDGDGDTDADTDADADT
120   DCDGDCDTDGDGDGDGDGDT
121   DCDADADADGDADTDGDADG
122   DTDGDTDTDTDTDADGDTDG
123   DTDADTDTDCDTDTDTDCDG
124   DCDCDTDCDTDTDTDCDGDT
125   DTDTDTDADGDGDTDTDGDG
126   DTDGDCDCDTDTDCDGDTDA
127   DGDTDGDGDCDADTDTDADC
128   DGDTDADTDTDTDTDADCDC
129   DCDGDTDTDTDADADTDGDG
130   DADADADCDTDTDCDCDTDC
131   DADTDGDADADADADADGDT
132   DCDTDTDTDADGDTDCDCDT
133   DCDADADADGDCDCDTDCDT
134   DGDTDADGDCDCDGDTDTDG
135   DCDTDADCDCDCDTDCDGDT
136   DTDCDCDGDADTDGDCDTDG
137   DTDCDTDTDTDCDGDCDTDG
138   DCDTDGDADGDGDGDTDGDA
139   DCDGDADTDCDCDCDGDCDA
140   DADADADGDCDGDGDCDCDT
141   DTDTDADADCDTDCDCDCDT
142   DGDCDADADGDCDCDTDCDA
143   DGDCDGDADCDCDGDADADT
144   DADTDADTDCDGDGDTDTDA
145   DTDGDCDGDTDGDGDGDCDG
146   DADTDGDGDTDTDGDTDTDG
147   DTDCDADTDTDGDTDCDGDG
148   DCDGDCDADADCDTDADTDC
149   DGDGDTDADTDCDADADGDC
150   DTDGDTDTDTDADADGDADA
151   DADTDTDCDADCDCDTDCDG
152   DADADADGDCDADADGDCDT
153   DGDADTDADADADCDCDGDA
154   DTDADCDADADTDTDADADA
155   DGDGDCDTDCDCDTDTDTDT
156   DGDGDADGDCDCDTDTDTDT
157   DTDTDTDTDTDGDGDADGDA
158   DTDTDTDTDCDADADCDGDT
159   DGDADADADADADADTDTDA
160   DTDTDADTDTDCDGDCDADA
161   DTDTDCDCDTDTDTDADGDT
162   DTDGDTDTDCDCDTDTDTDC
163   DTDADTDTDCDTDCDADCDT
164   DCDCDGDCDTDGDADADADC
165   DTDGDTDTDGDADADADGDT
166   DTDGDTDTDTDADGDCDADA
167   DADADCDCDCDCDADTDADC
168   DADGDADADADADTDTDCDA
169   DTDTDTDADCDTDADADCDG
170   DTDCDTDGDGDADADADGDA
171   DCDGDADCDADADADADCDT
172   DTDTDADGDADTDCDGDTDT
173   DADCDGDCDTDADADCDTDA
174   DTDGDADGDGDGDTDTDGDT
175   DCDTDGDTDGDGDADADTDG
176   DCDTDADCDADGDGDCDGDT
177   DTDGDTDADGDTDTDTDGDT
178   DADCDTDGDGDTDGDADCDG
179   DADADADCDTDCDADGDTDG
180   DTDTDADCDGDGDTDADCDA
181   DTDGDGDGDTDTDCDCDTDA
182   DTDTDGDGDGDCDTDTDGDC
183   DTDADTDCDCDCDTDGDADA
184   DADADTDGDADGDGDGDTDG
185   DGDTDGDGDCDTDCDTDGDA
186   DGDGDGDTDGDGDCDGDGDT
187   DTDCDTDGDADGDGDGDTDG
188   DGDCDGDGDTDTDCDTDGDA
189   DGDGDGDTDGDGDCDGDGDT
190   DADCDTDADADADCDCDTDC
191   DCDTDGDADGDTDADCDGDG
192   DTDGDADTDADCDADCDCDT
193   DADTDTDCDCDGDGDGDCDT
194   DADTDADCDTDTDADTDADT
195   DCDADADCDCDCDTDCDTDC
196   DGDADCDGDGDCDADCDTDT
197   DADTDCDCDGDCDCDTDGDG
198   DTDADCDTDGDADGDCDADA
199   DADADCDCDCDCDGDCDTDA
200   DADTDCDCDTDADADTDCDC
201   DTDTDCDTDCDTDTDGDADG
202   DGDADGDTDCDTDCDADGDC
203   DCDTDCDTDTDADADTDADC
204   DTDTDTDCDADTDGDTDTDT
205   DCDADGDADADTDADADTDA
206   DGDGDTDTDCDCDGDADADA
207   DTDADGDGDCDADGDGDGDG
208   DGDCDADTDTDADADCDTDG
209   DTDTDTDADTDADCDGDGDG
210   DCDADCDTDGDTDTDADCDT
211   DCDADADGDGDCDADCDTDG
212   DADCDCDCDCDGDTDTDADA
213   DADADCDTDTDADTDTDADC
214   DCDADGDTDADCDADCDTDC
215   DCDTDGDTDADTDCDADTDC
216   DADADADADGDCDCDADTDG
217   DTDADTDGDADCDGDCDTDT
218   DADCDTDGDGDADADCDGDG
219   DTDADADADTDTDCDADGDA
220   DGDADCDTDGDCDGDCDTDT
221   DTDCDCDADTDTDCDTDGDG
222   DCDTDTDTDADADTDGDADG
223   DGDADTDCDCDADTDTDCDG
224   DTDTDTDGDTDGDADADTDA
225   DTDCDADADGDGDCDCDADA
226   DTDCDGDTDCDTDGDADCDC
227   DTDGDCDCDTDCDADADCDC
228   DTDCDCDTDGDTDCDADADT
229   DGDCDTDGDGDCDGDGDCDG
230   DGDCDTDCDTDGDGDTDGDG
231   DTDGDGDTDTDCDTDGDGDT
232   DGDGDCDGDGDCDTDCDTDG
233   DADGDGDGDTDGDGDTDGDG
234   DCDTDCDTDGDADGDGDGDT
235   DGDGDCDGDGDTDTDCDTDG
236   DADGDGDGDTDGDGDCDGDG
237   DCDTDCDTDGDADGDGDGDA
238   DGDGDCDGDGDTDTDCDCDG
239   DGDTDGDGDTDGDGDCDTDC
240   DTDGDGDTDTDCDCDGDGDT
241   DGDADTDTDTDTDGDADTDT
242   DADTDGDADADADADGDADT
243   DGDGDCDADADADCDGDCDT
244   DADADTDADADGDGDGDGDG
245   DCDTDADTDGDADCDCDGDA
246   DADADADTDGDCDCDGDADT
247   DGDADADADADCDGDCDGDC
248   DTDADCDADGDTDCDTDGDA
249   DCDGDCDTDADADADGDGDC
250   DADADADCDTDTDGDADTDT
251   DCDTDGDTDCDGDCDTDADC
252   DTDGDADTDTDADCDGDGDT
253   DGDCDTDGDCDTDADTDCDG
254   DADTDGDGDTDTDTDCDADT
255   DTDGDGDTDGDADCDGDTDT
256   DTDCDCDGDGDCDCDTDTDG
257   DCDTDADADTDGDGDTDADA
258   DTDGDGDTDGDCDTDADCDT
259   DGDGDTDGDADTDTDTDTDG
260   DCDTDGDGDCDTDCDTDADA
261   DTDTDCDCDCDADADADTDG
262   DGDCDTDCDADADGDTDCDG
263   DGDTDGDADCDGDGDTDGDA
264   DTDADADTDTDCDADCDCDT
265   DTDTDADADTDGDADADTDA
266   DADTDTDTDCDCDGDTDCDA
267   DADTDADTDTDTDADCDCDT
268   DTDCDCDCDTDCDCDCDTDC
269   DADADTDCDGDGDTDTDGDA
270   DADTDGDTDCDGDCDCDCDT
271   DTDTDTDGDTDCDTDTDTDA
272   DGDCDGDCDTDGDGDTDADA
273   DADCDCDADTDADTDGDADA
274   DTDTDTDTDCDTDADTDTDG
275   DADTDTDGDTDGDADCDADA
276   DADADTDADADADCDTDTDA
277   DTDTDCDCDGDTDGDGDTDG
278   DTDCDTDTDTDGDCDGDTDT
279   DTDCDTDTDTDTDADTDADT
280   DGDTDTDGDCDCDADCDCDT
281   DTDTDADTDGDTDADTDGDT
282   DADTDTDTDTDCDTDADCDG
283   DTDTDTDGDCDTDADADCDA
284   DTDADCDTDGDCDGDTDADA
285   DTDADADGDGDADGDTDCDT
286   DTDADADTDCDADTDGDCDC
287   DADGDTDTDCDTDTDTDTDG
288   DGDGDTDADTDTDCDCDGDT
289   DTDADTDTDADTDTDGDCDG
290   DTDTDTDCDCDTDCDGDGDT
291   DTDTDCDCDTDTDCDTDGDG
292   DTDADADCDTDTDTDGDTDT
293   DCDGDGDCDTDADTDCDTDG
294   DCDTDTDADCDTDTDTDTDC
295   DTDTDADADADADADGDGDG
296   DCDTDTDCDGDGDTDADADG
297   DADTDADGDCDTDADTDTDG
298   DCDTDADTDTDTDCDADTDT
299   DGDTDTDTDCDTDTDGDCDT
300   DCDTDTDADTDTDADTDTDG
301   DGDGDCDTDTDADADCDTDC
302   DADADTDTDCDTDTDGDTDG
303   DGDGDTDTDADTDCDTDCDT
304   DCDTDGDADTDADTDTDADG
305   DCDGDCDTDCDADADTDTDA
306   DCDCDCDTDCDTDGDADCDT
307   DTDTDGDTDTDCDADGDGDG
308   DTDGDTDTDCDADGDTDTDA
309   DADTDTDCDTDCDCDCDGDT
310   DCDTDADADTDGDCDGDCDT
311   DTDCDCDCDTDGDTDTDTDT
312   DTDADTDGDTDTDADTDTDC
313   DTDCDTDCDTDGDTDADADA
314   DGDGDCDTDGDCDTDADTDT
315   DTDTDCDADTDTDTDTDTDG
316   DADCDGDTDTDADADADCDA
317   DADADADADADTDCDGDTDT
318   DTDCDTDTDADTDTDTDGDG
319   DADTDTDGDGDGDADTDADA
320   DADTDADADTDADTDGDGDC
321   DTDGDTDTDTDADTDTDTDT
322   DGDTDADADCDTDGDGDCDA
323   DADADTDTDADGDGDCDTDC
324   DTDGDGDADADADGDADCDG
325   DCDTDCDGDTDTDADGDCDG
326   DTDTDGDGDTDADADGDADT
327   DTDCDADGDGDADTDADADA
328   DADTDTDGDTDADGDCDTDG
329   DGDGDTDGDCDADADADADT
330   DADGDCDADADCDTDADADT
331   DCDTDTDGDADTDTDTDADA
332   DGDGDCDTDTDCDADADADA
333   DCDCDTDCDCDCDGDCDADA
334   DGDTDCDGDGDGDADGDGDT
335   DTDCDGDCDTDADADADADC
336   DGDCDCDTDCDGDCDGDTDT
337   DCDTDTDADGDADADTDADC
338   DCDGDGDADTDADADGDCDC
339   DTDTDCDTDADTDADTDCDT
340   DGDADTDTDTDGDCDTDTDG
341   DCDTDADTDTDGDGDGDCDG
342   DCDGDGDTDADADTDGDADT
343   DTDCDCDTDADCDGDADTDG
344   DADADADADTDADADADADA
345   DCDGDGDCDTDTDGDCDTDT
346   DGDTDTDCDTDCDGDADTDG
347   DADGDTDGDCDGDGDTDADC
348   DTDTDGDGDTDTDTDADADT
349   DADCDCDCDGDTDTDCDTDT
350   DGDGDADADTDGDADTDADA
351   DGDGDADADADGDADCDADG
352   DCDCDGDADTDTDADTDTDG
353   DADTDTDGDGDTDTDTDCDT
354   DADCDADTDGDCDTDCDGDT
355   DADADADTDTDADGDGDADT
356   DGDGDGDADTDADTDTDADT
357   DTDTDTDTDCDTDTDGDTDT
358   DCDADGDGDADCDTDTDADT
359   DCDTDADTDTDGDTDTDGDA
360   DTDADADADCDADGDGDCDG
361   DCDGDTDTDCDTDGDCDADT
362   DTDADGDCDTDGDADADCDA
363   DTDGDTDTDGDTDTDTDADT
364   DTDGDTDCDGDTDCDGDTDC
365   DTDGDGDADCDADGDADADT
366   DTDADCDTDTDTDADCDCDT
367   DTDTDTDGDTDCDGDGDTDA
368   DCDTDTDTDADTDADTDTDC
369   DTDCDTDTDADTDTDADCDT
370   DGDGDCDTDCDGDADADADA
371   DTDGDCDCDTDCDTDGDCDC
372   DTDADADADTDTDADCDADT
373   DGDTDTDGDGDCDGDTDTDG
374   DTDTDADADADTDADTDGDG
375   DCDGDADTDTDCDTDCDADA
376   DTDTDADADGDCDCDCDTDA
377   DCDTDGDTDTDGDADGDCDG
378   DTDTDGDGDCDTDTDTDADT
379   DADCDTDGDGDTDADADGDA
380   DADTDTDTDGDTDADTDADA
381   DCDGDCDADTDADTDGDADT
382   DADCDTDADADADCDADGDG
383   DCDTDTDTDTDTDCDTDADG
384   DTDADADTDTDADTDGDADT
385   DTDCDCDGDGDTDGDTDTDT
386   DADTDTDCDTDTDADTDTDT
387   DADADCDGDCDCDTDTDADT
388   DTDTDADTDCDADCDADCDG
389   DGDTDCDGDGDTDADTDTDT
390   DCDADADADCDCDADTDTDA
391   DADADTDTDTDADGDGDTDC
392   DADGDADADGDADTDGDADA
393   DADTDTDADADCDTDADADA
394   DADTDADTDADTDTDTDGDA
395   DADADADADGDTDTDTDTDC
396   DTDCDGDCDGDTDTDCDTDT
397   DTDGDTDCDTDTDGDCDGDA
398   DTDTDGDGDADTDTDTDGDC
399   DADTDCDADGDCDADTDTDT
400   DADCDADTDADTDADGDTDT
401   DADTDADTDADADCDCDCDA
402   DADCDCDTDADADGDCDCDG
403   DGDADGDGDTDTDADADADA
404   DADGDGDTDADGDTDCDTDC
405   DTDCDADGDADCDCDTDADT
406   DGDADTDTDTDTDGDADTDA
407   DADADTDTDCDADCDTDADT
408   DTDGDADCDTDCDTDTDCDT
409   DCDADGDCDGDTDCDTDTDA
410   DADTDCDTDADADGDCDTDA
411   DTDCDGDCDTDADTDGDTDT
412   DTDTDCDADADGDGDADTDT
413   DCDTDADADGDGDGDADADA
414   DADTDTDADADTDTDADADT
415   DADGDCDGDADCDGDADTDT
416   DTDADCDADGDADADGDCDA
417   DADGDGDTDTDADTDTDCDA
418   DCDTDCDADCDADTDADTDA
419   DTDTDGDADTDTDTDADTDG
420   DTDADCDTDGDTDTDTDCDC
421   DADTDTDADADADADADADG
422   DGDTDADADTDTDCDADADA
423   DTDGDADADADTDTDGDTDT
424   DADADADTDGDTDADADTDT
425   DADADTDTDTDTDGDTDTDT
426   DTDCDTDTDGDADTDGDTDT
427   DTDGDTDTDTDCDADTDCDA
428   DTDCDTDTDCDTDTDTDTDG
429   DCDTDCDADGDGDTDADADT
430   DTDGDADADADTDGDADADT
431   DADADTDTDCDGDCDCDTDC
432   DTDGDCDGDCDGDADTDTDT
433   DTDGDTDADADCDTDTDGDG
434   DTDADTDTDCDADADADGDC
435   DADADTDCDADGDGDCDGDA
436   DADTDCDCDGDTDTDADTDT
437   DGDTDTDTDCDTDCDCDCDG
438   DADTDGDTDADADADADGDG
439   DTDADCDTDGDTDTDADCDT
440   DGDTDADTDADTDTDCDADT
441   DCDTDGDADCDGDTDTDADA
442   DADCDCDTDGDADADADADT
443   DCDTDADCDGDCDADADTDT
444   DTDCDTDTDTDADTDTDTDC
445   DTDGDTDTDTDTDADCDGDT
446   DGDCDTDADADTDADADTDT
447   DTDTDGDADTDADTDGDGDT
448   DTDGDGDTDTDCDADADTDT
449   DCDCDTDTDCDCDADTDADA
450   DTDTDCDADGDADADGDTDA
451   DTDADADTDCDCDADADADC
452   DADADTDCDADGDGDADTDT
453   DADTDADTDTDGDADTDGDA
454   DADTDTDGDCDCDADTDCDA
455   DTDCDTDGDADTDADADTDC
456   DADGDGDADADTDADTDGDA
457   DTDGDADTDADADTDTDCDC
458   DGDCDTDCDCDTDTDCDTDG
459   DGDTDGDGDTDTDTDCDTDT
460   DTDGDTDTDCDCDGDCDADA
461   DADADTDGDADTDADADTDG
462   DTDTDADCDTDCDADADADC
463   DTDTDTDTDADADADADTDT
464   DADADTDADADCDGDTDTDC
465   DGDGDGDCDADADADGDGDA
466   DTDTDTDADADTDADCDGDA
467   DGDTDTDGDTDCDGDADADT
468   DTDGDTDTDTDGDTDADADA
469   DGDTDCDTDADADTDADCDT
470   DTDCDTDADADADTDCDCDT
471   DCDADADADTDGDTDADTDT
472   DADTDCDTDADTDTDGDADC
473   DGDGDCDTDCDTDADADTDC
474   DTDADTDTDADGDTDTDGDT
475   DTDADGDTDGDCDADCDCDT
476   DADADADGDADTDADTDTDT
477   DTDADGDADTDADADCDCDT
478   DTDCDCDTDCDADADTDTDC
479   DCDTDTDTDCDTDADCDTDG
480   DTDTDGDADTDTDTDGDCDC
481   DADADCDTDGDADCDCDADG
482   DADTDADTDTDGDADTDTDG
483   DADGDGDGDTDTDTDGDADT
484   DADTDTDTDGDADGDGDTDT
485   DCDADGDCDADADGDGDTDG
486   DADTDGDCDTDTDTDADGDA
487   DTDTDTDTDTDCDADTDTDT
488   DGDCDTDGDCDTDGDGDCDT
489   DCDTDCDADGDCDGDTDGDG
490   DCDADCDTDGDTDTDGDCDA
491   DGDGDCDGDGDTDGDTDTDA
492   DADTDADCDTDGDADCDCDG
493   DCDCDTDCDADCDCDTDCDT
494   DGDTDTDTDTDADTDCDTDT
495   DCDTDGDCDTDGDGDTDGDG
496   DTDTDCDGDTDTDCDGDGDT
497   DADTDTDTDTDTDADADTDG
498   DGDCDGDADTDGDTDTDTDT
499   DADGDGDGDCDTDADTDCDA
500   DGDTDTDCDGDCDGDCDADT
501   DTDADADADGDADCDTDADA
502   DTDADGDCDCDADTDTDCDA
503   DADADADADTDADTDTDGDT
504   DCDTDGDTDGDCDCDADCDG
505   DTDADTDTDCDTDTDADCDG
506   DCDTDTDTDCDADGDGDTDC
507   DADGDADADGDGDGDTDTDC
508   DTDADTDCDTDCDTDGDTDT
509   DGDGDCDCDADGDADADTDG
510   DTDCDCDCDTDTDTDTDADT
511   DTDADCDTDGDGDTDCDGDT
512   DGDTDGDADCDTDGDGDTDG
513   DADADTDCDTDGDCDCDADA
514   DTDGDTDADADADTDADADT
515   DCDCDADTDTDTDCDADGDA
516   DCDGDADTDTDGDADGDCDG
517   DTDCDADADADADTDGDTDA
518   DGDGDTDADTDTDTDCDCDA
519   DTDGDADGDCDGDTDTDTDT
520   DTDCDCDTDGDTDTDGDCDA
521   DADTDGDGDCDTDGDGDCDG
522   DGDTDADADTDADTDTDGDT
523   DTDCDTDGDGDADTDADTDT
524   DADCDCDADGDCDADADGDG
525   DCDCDGDADTDADGDTDTDT
526   DGDADGDTDTDCDTDTDCDT
527   DADCDTDCDADGDGDCDADA
528   DGDTDGDADTDGDTDTDADT
529   DTDADCDTDADADTDCDADA
530   DADGDADADGDTDADTDTDG
531   DCDTDADCDADADCDGDGDT
532   DTDADADTDTDTDGDCDGDT
533   DGDADTDGDGDADCDADGDA
534   DCDTDCDTDTDTDTDADCDT
535   DCDGDGDTDGDGDCDCDTDC
536   DADCDTDGDADTDTDADTDA
537   DADADADADCDADCDTDTDC
538   DTDCDADADGDADTDTDCDT
539   DGDGDCDGDTDADCDCDGDT
540   DTDCDCDTDGDTDCDTDADA
541   DADADTDCDCDCDTDTDTDA
542   DADTDCDGDGDCDCDTDCDC
543   DTDGDTDTDTDADGDCDTDC
544   DCDCDGDCDTDCDTDGDADT
545   DTDCDCDADADCDGDADGDG
546   DADADADGDCDADCDGDTDT
547   DADTDADCDGDTDGDCDTDC
548   DGDTDCDADADADGDCDADA
549   DCDCDADTDADGDTDADCDG
550   DCDGDCDCDCDTDGDTDADG
551   DCDGDGDCDGDCDADTDTDA
552   DADGDCDGDCDGDGDCDGDG
553   DGDTDGDTDGDGDTDGDGDT
554   DTDADCDGDCDGDCDADGDC
555   DGDTDGDADCDCDGDCDTDA
556   DCDADCDTDTDGDCDCDADG
557   DCDGDCDCDCDTDADGDCDG
558   DCDCDCDGDCDTDCDCDTDT
559   DTDCDGDCDTDTDTDCDTDT
560   DCDCDCDTDTDCDCDTDTDT
561   DCDTDCDGDCDCDADCDGDT
562   DTDCDGDCDCDGDGDCDTDT
563   DTDCDCDCDCDGDTDCDADA
564   DGDCDTDCDTDADADADTDC
565   DGDGDGDGDGDCDTDCDCDC
566   DTDTDTDADGDGDGDTDTDC
567   DCDGDADTDTDTDADGDTDG
568   DCDTDTDTDADCDGDGDCDA
569   DCDCDTDCDGDADCDCDCDC
570   DADADADADADADCDTDTDG
571   DADTDTDTDGDGDGDTDGDA
572   DTDGDGDTDTDCDADCDGDT
573   DADGDTDGDGDGDCDCDADT
574   DCDGDCDCDCDTDGDADTDA
575   DGDADCDGDGDTDTDTDTDT
576   DCDGDCDCDCDTDTDTDGDA
577   DCDGDTDTDGDGDADGDTDC
578   DCDADCDGDTDTDCDTDTDT
579   DADADTDADGDTDGDGDADC
580   DTDCDTDTDGDTDTDCDCDA
581   DADADCDTDGDGDADADCDA
582   DADCDADCDTDCDADADCDC
583   DCDTDADTDCDTDCDGDGDG
584   DADCDGDGDADTDCDGDCDT
585   DTDCDADTDGDTDGDGDCDA
586   DGDGDADGDADADADADADA
587   DGDGDCDTDGDCDADCDCDG
588   DGDTDGDCDGDTDCDADGDC
589   DADGDADADTDADTDGDTDG
590   DADTDADCDADGDGDADTDA
591   DTDADTDTDCDCDGDCDTDT
592   DCDCDTDCDGDCDTDCDADC
593   DTDGDADCDTDCDGDCDTDA
594   DCDGDCDTDCDGDGDTDCDG
595   DTDTDCDGDADCDTDGDCDG
596   DGDCDGDADGDCDGDGDADA
597   DADTDGDGDCDTDTDADCDG
598   DADADCDGDGDGDGDCDGDG
599   DADGDADTDTDTDCDCDTDG
600   DGDADADGDADTDGDCDCDA
601   DGDGDADADGDADTDADCDT
602   DTDADADCDADGDGDGDADA
603   DGDTDGDADGDADGDGDGDC
604   DCDGDCDGDGDCDADADADG
605   DCDCDGDTDTDTDTDTDCDC
606   DADTDADGDGDCDTDCDCDG
607   DCDCDCDCDCDCDTDGDADC
608   DADADGDCDADTDCDADCDG
609   DADADADTDCDTDGDADCDG
610   DCDTDCDADADADTDCDADG
611   DTDGDGDTDGDGDCDGDADA
612   DADCDCDCDGDADCDADGDG
613   DADCDTDADTDADADADGDA
614   DTDADCDCDADGDGDCDGDT
615   DTDTDCDCDCDCDCDTDGDG
616   DCDGDGDCDTDCDCDCDTDC
617   DGDTDGDCDGDCDTDCDTDC
618   DCDTDGDTDTDCDCDTDGDC
619   DCDTDTDTDCDGDGDTDTDT
620   DADCDCDGDGDTDGDTDCDA
621   DTDTDCDCDGDCDTDGDTDT
622   DADTDGDGDCDCDGDCDGDT
623   DTDTDGDTDCDTDCDADTDT
624   DCDCDADCDGDCDCDTDGDA
625   DCDADCDTDCDADGDTDTDC
626   DCDGDGDGDTDADGDGDCDA
627   DGDTDTDCDGDCDTDCDCDA
628   DADGDCDTDGDGDADCDTDG
629   DTDADTDGDCDADCDGDADA
630   DCDCDCDCDCDCDGDTDTDC
631   DADGDTDCDCDGDADCDCDG
632   DCDTDGDCDGDCDCDTDTDA
633   DTDCDCDGDGDTDADADCDT
634   DADTDCDGDTDCDTDTDGDA
635   DGDTDCDCDADADCDCDCDG
636   DGDADADADGDADCDADTDG
637   DCDADADADADGDCDADCDC
638   DADCDTDGDGDCDADGDCDA
639   DGDCDCDADCDTDGDGDTDA
640   DADTDTDGDADTDTDTDADG
641   DADGDGDADGDTDTDADGDT
642   DCDTDTDGDADADGDTDCDA
643   DTDGDCDGDCDCDGDGDTDT
644   DADADGDGDCDTDADADADC
645   DTDGDADADADGDGDADCDA
646   DADGDTDTDTDTDGDGDTDG
647   DADCDTDGDCDGDCDTDCDC
648   DTDCDCDADADGDCDCDADG
649   DTDTDADCDCDTDCDGDGDT
650   DTDCDADADADGDADGDTDT
651   DGDGDTDADGDCDTDCDADG
652   DADGDADADCDCDTDTDCDG
653   DADADADADADCDCDGDCDC
654   DCDTDGDCDADADGDGDCDG
655   DGDTDTDTDTDTDTDCDGDT
656   DTDTDTDCDADGDADGDCDA
657   DADGDADGDADTDTDADCDG
658   DCDGDCDADGDADCDCDADA
659   DADADCDGDADTDCDTDCDA
660   DADGDADADGDADTDCDADT
661   DCDTDTDADTDTDADADGDG
662   DGDGDTDCDTDGDADCDGDC
663   DTDCDADGDTDGDGDADADC
664   DGDADADADADCDTDCDADC
665   DGDTDTDADADGDGDGDADT
666   DTDTDTDGDGDTDCDADTDG
667   DADGDADTDTDADTDCDADA
668   DADADADGDGDADTDCDTDT
669   DCDADCDCDTDADGDADTDC
670   DCDTDTDTDTDADADADTDT
671   DADADADADADTDGDADADG
672   DTDTDTDTDADADADTDCDA
673   DADTDCDTDADADADGDTDA
674   DTDADTDADTDGDADGDTDA
675   DADADCDTDTDGDGDTDCDT
676   DGDADCDADGDTDTDADCDC
677   DADADTDGDCDTDTDADADT
678   DCDADGDTDGDADGDGDCDA
679   DCDCDTDADTDCDTDCDADG
680   DCDGDADTDCDTDGDTDCDT
681   DADTDTDTDCDGDTDTDCDA
682   DTDCDCDADTDADGDTDTDG
683   DCDCDTDGDADCDTDCDCDC
684   DCDGDTDCDGDTDGDTDADG
685   DADTDADADCDTDADCDGDA
686   DTDADCDGDGDGDADGDGDG
687   DCDTDTDADCDCDADTDCDT
688   DGDGDCDCDCDCDADGDTDG
689   DCDTDGDCDADADTDGDADT
690   DADCDCDGDCDGDADGDADC
691   DCDCDADCDGDCDTDCDADC
692   DCDGDGDCDTDCDCDADGDA
693   DTDTDTDADTDCDADGDCDA
694   DADTDADADADCDCDADGDC
695   DCDADGDCDCDGDADTDTDC
696   DGDADGDCDTDCDGDCDCDC
697   DCDGDGDGDGDADTDCDGDA
698   DCDCDADGDTDTDGDGDTDG
699   DADTDTDTDTDGDADADCDT
700   DTDTDTDGDCDTDTDTDGDC
701   DCDADCDGDGDADADCDGDG
702   DTDCDTDGDCDGDTDTDGDT
703   DCDGDGDGDADADGDADTDG
704   DCDGDTDGDADTDCDTDGDA
705   DTDCDCDTDTDCDADADCDT
706   DCDADGDCDADADADADGDT
707   DTDCDGDADTDTDTDADTDT
708   DCDADADCDADADADGDCDC
709   DGDCDCDGDTDCDCDCDGDT
710   DCDADADGDTDCDADGDCDG
711   DTDADADTDGDCDTDCDTDG
712   DCDCDADGDTDGDTDTDADC
713   DADADCDCDADADTDTDADA
714   DCDCDADADTDTDCDTDGDA
715   DTDTDADGDADADADADADC
716   DTDCDADTDCDGDADGDCDA
717   DTDCDADADADTDGDADADA
718   DCDTDGDCDADADTDTDTDA
719   DTDTDCDADTDADTDCDADG
720   DGDADTDTDADTDCDADADT
721   DADCDCDADTDADTDTDTDT
722   DTDGDADADADADADGDCDC
723   DGDTDTDTDCDTDGDTDADA
724   DTDGDADADGDGDADGDADA
725   DADADCDTDCDADCDCDGDA
726   DGDGDCDADGDTDTDCDCDA
727   DTDADGDGDADTDGDGDCDA
728   DADGDADTDCDCDTDGDGDT
729   DADTDCDGDGDTDCDTDGDC
730   DGDADTDTDCDCDGDADCDT
731   DCDGDTDCDCDADADCDADT
732   DCDADADTDADCDADADCDC
733   DTDADTDTDADADTDTDTDC
734   DCDCDCDTDCDGDTDCDADA
735   DADADADTDADADGDGDTDT
736   DADTDCDADADGDTDGDADG
737   DADADADTDCDADCDCDADT
738   DGDADGDTDGDADCDGDADC
739   DTDGDADADTDCDCDGDGDT
740   DGDADGDADADTDGDGDCDA
741   DADADADGDCDTDTDADTDG
742   DCDADTDTDTDCDTDTDTDC
743   DCDADGDADCDTDTDGDTDT
744   DCDADADCDADGDGDCDCDA
745   DGDCDCDADTDTDADCDGDC
746   DTDCDGDTDCDADTDCDADA
747   DADADTDCDADCDTDCDGDC
748   DADTDCDADADCDCDADADA
749   DCDCDGDTDTDADTDTDCDA
750   DTDTDCDGDTDGDADTDTDG
751   DCDGDCDCDTDGDADGDCDG
752   DADGDADCDGDADADADTDA
753   DCDGDCDGDADTDCDGDCDT
754   DGDTDTDADADADADGDGDA
755   DCDADADTDTDADCDADADA
756   DCDADGDGDADADTDCDGDA
757   DADTDGDCDADADCDCDGDG
758   DCDGDCDADGDGDADADCDA
759   DCDTDGDCDCDADGDCDGDC
760   DADTDCDADADCDADADTDA
761   DTDTDTDTDCDADCDCDTDG
762   DADADTDCDADGDGDADTDA
763   DTDTDCDTDTDCDTDADADT
764   DADCDCDTDGDGDADADTDG
765   DCDTDGDTDTDTDTDCDCDC
766   DGDGDGDGDADTDCDGDCDA
767   DGDTDGDGDTDGDADGDTDA
768   DADCDCDADTDGDCDADTDC
769   DADTDCDADGDGDADGDTDA
770   DCDGDGDADTDADADADADT
771   DGDCDTDTDGDADTDGDGDT
772   DCDGDGDADADGDADGDGDC
773   DADTDADADADTDTDCDCDG
774   DTDCDADGDCDCDADGDTDT
775   DTDADGDTDCDTDGDADCDC
776   DADTDCDTDCDADTDCDTDG
777   DTDADADCDADTDCDADTDT
778   DGDGDCDADADCDGDCDTDA
779   DCDCDTDTDTDGDCDCDADT
780   DGDTDTDTDCDADGDADADA
781   DCDADADCDTDCDTDGDGDC
782   DGDCDADTDCDGDGDGDCDT
783   DTDCDCDCDADTDADCDADA
784   DTDCDGDADTDADGDADTDT
785   DGDTDCDGDCDADCDCDTDG
786   DADTDTDGDCDCDCDGDADC
787   DADTDTDADTDCDGDCDGDA
788   DGDCDCDCDADTDTDTDADT
789   DADCDCDCDADTDADTDADA
790   DADTDCDADGDCDADTDCDC
791   DADTDGDTDTDGDGDADADT
792   DTDTDADADTDCDGDCDGDG
793   DCDCDTDCDGDADGDCDADA
794   DGDADCDGDTDTDTDCDCDC
795   DGDTDTDGDADADTDADTDG
796   DGDCDTDCDADTDADADCDA
797   DCDCDCDCDTDTDGDTDADT
798   DTDADCDTDGDTDTDTDADT
799   DGDTDADADGDCDADGDADC
800   DADGDTDTDTDTDADTDTDG
801   DTDTDCDADTDGDADTDGDA
802   DTDADTDADTDTDTDTDTDA
803   DTDCDTDTDGDTDGDCDADA
804   DTDGDTDADADCDADTDCDA
805   DGDADGDADTDTDTDTDGDA
806   DGDADCDADCDADADCDGDT
807   DGDGDCDTDTDTDCDCDCDC
808   DCDCDCDCDCDCDCDCDCDT
809   DGDCDADGDGDTDCDTDCDG
810   DGDGDCDTDADTDTDCDTDT
811   DTDTDGDADTDTDTDADTDA
812   DADGDGDGDADTDTDTDTDG
813   DCDCDGDADTDTDTDCDGDG
814   DCDCDTDADTDTDGDGDTDT
815   DADADADADADADTDGDADG
816   DCDTDGDADTDTDTDADADC
817   DADADADADADTDTDTDADA
818   DCDGDCDGDADADTDTDTDT
819   DADADCDADADADADTDADT
820   DTDADADCDGDTDTDTDADC
821   DADADTDTDTDADADADTDA
822   DTDTDTDGDCDTDTDADTDA
823   DCDADADTDCDTDTDCDCDT
824   DGDTDTDTDTDTDGDGDGDG
825   DCDTDTDTDTDCDTDGDADT
826   DTDADTDCDADADCDCDGDG
827   DGDGDTDADCDADTDADTDG
828   DADTDTDGDADCDADTDGDC
829   DTDADGDTDTDTDTDADCDG
830   DADTDTDADCDCDGDTDTDC
831   DADTDCDGDADTDTDCDTDC
832   DTDTDGDTDTDTDGDCDTDC
833   DCDADGDADCDTDCDTDCDA
834   DGDGDCDADADTDGDADCDC
835   DTDGDADTDADGDCDCDTDT
836   DTDGDTDADGDADCDCDTDC
837   DTDCDADADADADADTDADG
838   DCDTDADCDCDCDTDCDTDC
839   DCDGDGDCDADTDGDADADT
840   DTDTDADTDCDADGDCDTDA
841   DGDADADCDGDGDTDTDGDA
842   DADTDADTDCDADTDADTDT
843   DGDADTDGDGDTDGDADTDT
844   DTDGDADCDTDGDTDCDTDC
845   DCDGDGDCDCDTDTDTDCDT
846   DCDADCDCDCDTDTDTDTDG
847   DADADTDCDTDTDTDADCDC
848   DTDADCDADCDADTDTDADC
849   DTDCDADGDGDCDADTDTDG
850   DCDADTDTDTDADADADADT
851   DADTDADTDGDADGDGDGDT
852   DTDCDTDADADADADADTDT
853   DTDTDTDADTDCDCDTDTDG
854   DCDGDTDTDGDADADADTDA
855   DADADGDGDCDTDTDCDTDC
856   DCDCDGDCDADADADADGDT
857   DADTDTDADCDADGDGDGDT
858   DCDADTDADADTDGDTDTDT
859   DTDTDGDGDTDADCDADADC
860   DCDGDADTDTDTDADGDCDT
861   DTDTDADTDGDCDTDCDTDG
862   DADGDGDCDTDTDTDADTDT
863   DGDCDTDTDADADTDTDTDT
864   DGDCDTDADADTDTDCDTDT
865   DTDGDCDCDTDTDGDCDCDT
866   DGDTDADTDGDADTDTDTDA
867   DTDTDGDGDADTDGDTDT

Samples:

sample_1: M13 bacteriophage, [U-99% 13C; U-99% 15N], 300 mg/ml; ssdDNA 300 mg/ml; TRIS 10 mM; PEG 8000 5%; MgCl2 5 mM

sample_2: M13 bacteriophage, [U-100% 13C; U-100% 15N], 300 mg/ml; ssdDNA 300 mg/ml; TRIS 10 mM; PEG 8000 5%; MgCl2 5 mM

sample_3: M13 bacteriophage, [U-100% 13C; U-100% 15N], 300 mg/ml; ssdDNA 300 mg/ml; TRIS 10 mM; PEG 8000 5%; MgCl2 5 mM

sample_conditions_1: ionic strength: 5 mM; pH: 8; pressure: ambient atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D NCAsample_1solidsample_conditions_1
2D NCOsample_1solidsample_conditions_1
3D NCACXsample_1solidsample_conditions_1
3D NCOCXsample_1solidsample_conditions_1
2D DARRsample_1solidsample_conditions_1
2D RFDRsample_1solidsample_conditions_1
2D DARRsample_2solidsample_conditions_1
2D DARRsample_3solidsample_conditions_1

Software:

SPARKY v3.113, Goddard - chemical shift assignment, data analysis

NMRPipe v2012.090.12.09, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMR spectrometers:

  • Bruker Avance-III 600 MHz

Related Database Links:

BMRB 17728 19734 2590 2591 2592 4197 4209
PDB
EMBL CAA23861 CAA23871
GB AAA32207 AAA32214 AAA32220 AAA32308 AAB24445
PRF 0812197K
REF NP_510890 YP_009111292 YP_009111302
SP P69539 P69540 P69541