BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19698

Title: Solution NMR structure of a preQ1 Class II riboswitch from Streptococcus pneumoniae   PubMed: 24469808

Authors: Kang, Mijeong; Eichhorn, Catherine; Feigon, Juli

Citation: Kang, Mijeong; Eichhorn, Catherine; Feigon, Juli. "Structural determinants for ligand capture by a class II preQ1 riboswitch."  Proc. Natl. Acad. Sci. U.S.A. 111, E663-E671 (2014).

Assembly members:
RNA_(59-MER), polymer, 59 residues, 18903.389 Da.
7-DEAZA-7-AMINOMETHYL-GUANINE, non-polymer, 179.179 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(59-MER): GCUUGGUGCUUAGCUUCUUU CACCAAGCAUAUUACACGCG GAUAACCGCCAAAGGAGAA

Data sets:
Data typeCount
13C chemical shifts399
15N chemical shifts20
1H chemical shifts620

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all