BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19692

Title: NMR Localization of Divalent Cations at the Active Site of the Neurospora VS Ribozyme Provides Insights Into RNA-Metal Ion Interactions   PubMed: 24364590

Authors: Bonneau, Eric; Legault, Pascale

Citation: Bonneau, Eric; Legault, Pascale. "NMR Localization of Divalent Cations at the Active Site of the Neurospora VS Ribozyme Provides Insights into RNA-Metal-Ion Interactions."  Biochemistry 53, 579-590 (2014).

Assembly members:
RNA_(26-MER), polymer, 26 residues, 8421.162 Da.
entity_MG, non-polymer, 24.305 Da.
entity_HOH, water, 18.015 Da.

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Neurospora

Entity Sequences (FASTA):
RNA_(26-MER): GAGCUGCAGCACGAAAGUGA CGGCUC

Data sets:
Data typeCount
13C chemical shifts173
15N chemical shifts91
1H chemical shifts232

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (26-MER)1
2MAGNESIUM ION_12
3MAGNESIUM ION_22
4MAGNESIUM ION_32
5MAGNESIUM ION_42
6MAGNESIUM ION_52
7water_13
8water_23
9water_33
10water_43
11water_53
12water_63
13water_73
14water_83
15water_93

Entities:

Entity 1, RNA (26-MER) 26 residues - 8421.162 Da.

1   GAGCUGCAGC
2   ACGAAAGUGA
3   CGGCUC

Entity 2, MAGNESIUM ION_1 - Mg - 24.305 Da.

1   MG

Entity 3, water_1 - 18.015 Da.

1   HOH

Samples:

sample_1: RNA (26-MER), [U-100% 15N], 1 mM; Mg2+, naturall abundance, 5 mM; KCl, naturall abundance, 50 mM

sample_2: RNA (26-MER), [U-100% 13C; U-100% 15N], 0.9 mM; Mg2+, naturall abundance, 5 mM; KCl, naturall abundance, 50 mM

sample_3: RNA (26-MER), phosphorothioate, 0.2 – 0.4 mM; Mg2+, naturall abundance, 5 mM; KCl, naturall abundance, 50 mM

sample_4: RNA (26-MER), [U-100% 13C; U-100% 15N], 0.9 mM; Mg2+, naturall abundance, 5 mM; KCl, naturall abundance, 50 mM

sample_conditions_1: ionic strength: 55 mM; pH: 6.5; pressure: 1 atm; temperature: 273 K

sample_conditions_2: ionic strength: 55 mM; pH: 6.5; pressure: 1 atm; temperature: 273 K

sample_conditions_3: ionic strength: 55 mM; pH: 6.5; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1anisotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlysample_1anisotropicsample_conditions_1
2D 1H-13C HSQCsample_2anisotropicsample_conditions_2
2D 1H-15N HSQC long-rangesample_4anisotropicsample_conditions_1
1D 31Psample_3anisotropicsample_conditions_3

Software:

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMRView, Johnson, One Moon Scientific - data analysis

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

NMR spectrometers:

  • Varian INOVA 500 MHz
  • Varian INOVA 600 MHz

Related Database Links: