BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19662

Title: NMR structure of the I-V kissing-loop interaction of the Neurospora VS ribozyme   PubMed: 24325625

Authors: Bouchard, Patricia; Legault, Pascale

Citation: Bouchard, Patricia; Legault, Pascale. "Structural insights into substrate recognition by the neurospora varkud satellite ribozyme: importance of u-turns at the kissing-loop junction."  Biochemistry 53, 258-269 (2014).

Assembly members:
RNA_(5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), polymer, 22 residues, 7049.290 Da.
RNA_(5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), polymer, 21 residues, 6721.066 Da.

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'): GAGCAGCAUCGUCGGCUGCU CA
RNA_(5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'): GCGGCAGUUGACUACUGUCG C

Data sets:
Data typeCount
13C chemical shifts186
15N chemical shifts67
1H chemical shifts231

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all