BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19634

Title: Solution structure of the CR4/5 domain of medaka telomerase RNA   PubMed: 24335084

Authors: Kim, Nak-Kyoon; Zhang, Qi; Feigon, Juli

Citation: Kim, Nak-Kyoon; Zhang, Qi; Feigon, Juli. "Structure and sequence elements of the CR4/5 domain of medaka telomerase RNA important for telomerase function."  Nucleic Acids Res. 42, 3395-3408 (2014).

Assembly members:
CR4/5 domain of medaka telomerase RNA, polymer, 53 residues, 135.128 Da.

Natural source:   Common Name: Japanese medaka   Taxonomy ID: 8090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Oryzias latipes

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Oryzias latipes

Entity Sequences (FASTA):
CR4/5 domain of medaka telomerase RNA: GGAAACGCCGCGGUCAGCUC GGCUGCUGCGAAGAGUUCGU CUCUGUUGUUUCC

Data sets:
Data typeCount
13C chemical shifts335
15N chemical shifts65
1H chemical shifts463

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1CR4/5 domain of medaka telomerase RNA1

Entities:

Entity 1, CR4/5 domain of medaka telomerase RNA 53 residues - 135.128 Da.

1   GGAAACGCCG
2   CGGUCAGCUC
3   GGCUGCUGCG
4   AAGAGUUCGU
5   CUCUGUUGUU
6   UCC

Samples:

mdCR4-5-H2O: mdCR4/5 1.2 mM; sodium phosphate 10 mM; potassium chloride 100 mM

mdCR4-5-D2O: mdCR4/5 1.2 mM; sodium phosphate 10 mM; potassium chloride 100 mM

FL-mdCR4-5-H2O: mdCR4/5, [U-13C; U-15N], 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

A-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Ade, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

U-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Ura, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

G-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Gua, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

C-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Cyt, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

D-mdCR4-5-D2O: mdCR4/5, [U-2H], 1.5 mM; sodium phosphate 10 mM; potassium chloride 100 mM

D-mdCR4-5-H2O: mdCR4/5, [U-2H], 1.5 mM; sodium phosphate 10 mM; potassium chloride 100 mM

mdCR4-5-293: ionic strength: 10 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

mdCR4-5-283: ionic strength: 10 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCFL-mdCR4-5-H2OisotropicmdCR4-5-283
2D 1H-13C HSQCFL-mdCR4-5-H2OisotropicmdCR4-5-293
2D 1H-13C HSQCA-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-13C HSQCU-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-13C HSQCG-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-13C HSQCC-mdCR4-5-D2OisotropicmdCR4-5-293
2D DQF-COSYmdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H COSYmdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H NOESYmdCR4-5-H2OisotropicmdCR4-5-283
2D 1H-1H NOESYmdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H NOESYD-mdCR4-5-H2OisotropicmdCR4-5-283
2D 1H-1H NOESYD-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H TOCSYmdCR4-5-D2OisotropicmdCR4-5-293
3D HCCH-TOCSYA-mdCR4-5-D2OisotropicmdCR4-5-293
3D HCCH-TOCSYU-mdCR4-5-D2OisotropicmdCR4-5-293
3D HCCH-TOCSYG-mdCR4-5-D2OisotropicmdCR4-5-293
3D HCCH-TOCSYmdCR4-5-D2OisotropicmdCR4-5-293
2D HNN-COSYFL-mdCR4-5-H2OisotropicmdCR4-5-283
2D 1H-1H filter/edited NOESYA-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H filter/edited NOESYU-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H filter/edited NOESYG-mdCR4-5-D2OisotropicmdCR4-5-293
2D 1H-1H filter/edited NOESYC-mdCR4-5-D2OisotropicmdCR4-5-293

Software:

xwinnmr v3.5, Bruker Biospin - collection, data analysis, processing

TOPSPIN, Bruker Biospin - collection, data analysis, processing

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

Molmol, Koradi, Billeter and Wuthrich - data analysis

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - geometry optimization, refinement, structure solution

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker DRX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: