BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19544

Title: Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL1)/RsmE(dimer) 2:1 complex   PubMed: 24561806

Authors: Duss, Olivier; Diarra Dit Konte, Nana; Michel, Erich; Schubert, Mario; Allain, Frederic

Citation: Duss, Olivier; Michel, Erich; Diarra Dit Konte, Nana; Schubert, Mario; Allain, Frederic H-T. "Molecular basis for the wide range of affinity found in Csr/Rsm protein-RNA recognition."  Nucleic Acids Res. ., .-. (2014).

Assembly members:
RsmE, polymer, 65 residues, 6405.423 Da.
SL1(RsmZ), polymer, 22 residues, 7112.354 Da.

Natural source:   Common Name: g-proteobacteria   Taxonomy ID: 294   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Pseudomonas fluorescens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RsmE: MLILTRKVGESINIGDDITI TILGVSGQQVRIGINAPKDV AVHREEIYQRIQAGLTAPDK RETPH
SL1(RsmZ): GGGUGUCGACGGAUAGACAC CC

Data sets:
Data typeCount
13C chemical shifts360
15N chemical shifts78
1H chemical shifts648

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RsmE_11
2SL1(RsmZ)_12
3RsmE_21
4SL1(RsmZ)_22

Entities:

Entity 1, RsmE_1 65 residues - 6405.423 Da.

1   METLEUILELEUTHRARGLYSVALGLYGLU
2   SERILEASNILEGLYASPASPILETHRILE
3   THRILELEUGLYVALSERGLYGLNGLNVAL
4   ARGILEGLYILEASNALAPROLYSASPVAL
5   ALAVALHISARGGLUGLUILETYRGLNARG
6   ILEGLNALAGLYLEUTHRALAPROASPLYS
7   ARGGLUTHRPROHIS

Entity 2, SL1(RsmZ)_1 22 residues - 7112.354 Da.

1   GGGUGUCGAC
2   GGAUAGACAC
3   CC

Samples:

sample_1: RsmE, [U-100% 15N], 1 mM; SL1(RsmZ) 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; H2O 95%; D2O, [U-100% 2H], 5%

sample_2: RsmE, [U-100% 15N], 1 mM; SL1(RsmZ) 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; D2O, [U-100% 2H], 100%

sample_3: RsmE, [U-100% 13C; U-100% 15N], 1 mM; SL1(RsmZ) 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; H2O 95%; D2O, [U-100% 2H], 5%

sample_4: RsmE, [U-100% 13C; U-100% 15N], 1 mM; SL1(RsmZ) 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; D2O, [U-100% 2H], 100%

sample_5: RsmE, [U-100% 15N], 1 mM; SL1(RsmZ), [U-100% 13C; U-100% 15N]-Ade/Ura RNA, 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; H2O 95%; D2O, [U-100% 2H], 5%

sample_6: RsmE, [U-100% 15N], 1 mM; SL1(RsmZ), [U-100% 13C; U-100% 15N]-Ade/Ura RNA, 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; D2O, [U-100% 2H], 100%

sample_7: RsmE, [U-100% 15N], 1 mM; SL1(RsmZ), [U-100% 13C; U-100% 15N]-Cyt/Gua RNA, 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; H2O 95%; D2O, [U-100% 2H], 5%

sample_8: RsmE, [U-100% 15N], 1 mM; SL1(RsmZ), [U-100% 13C; U-100% 15N]-Cyt/Gua RNA, 1 mM; potassium phosphate 0.05 mM; sodium chloride 0.03 mM; D2O, [U-100% 2H], 100%

sample_conditions_1: ionic strength: 0.18 M; pH: 7.2; pressure: 1 atm; temperature: 313 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_3isotropicsample_conditions_1
3D 1Fe3Ff NOESYsample_4isotropicsample_conditions_1
3D HCCH-TOCSYsample_4isotropicsample_conditions_1
3D HNCAsample_3isotropicsample_conditions_1
3D HNCACBsample_3isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-15N HSQCsample_7isotropicsample_conditions_1
2D 1H-13C HSQCsample_6isotropicsample_conditions_1
2D 1H-13C HSQCsample_8isotropicsample_conditions_1
3D 1H-13C NOESYsample_6isotropicsample_conditions_1
3D 1H-13C NOESYsample_8isotropicsample_conditions_1
3D 1Fe3Ff NOESYsample_6isotropicsample_conditions_1
3D 1Fe3Ff NOESYsample_8isotropicsample_conditions_1
3D HCCH-TOCSYsample_6isotropicsample_conditions_1
3D HCCH-TOCSYsample_8isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - processing

SPARKY, Goddard - chemical shift assignment, data analysis

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Bruker Avance 500 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 900 MHz

Related Database Links:

BMRB 15257 19534 19546 19547 19548 19549
PDB
DBJ BAO61455 BAQ73744 BAQ80031
GB AAT27429 AAY91370 AEL31265 AGL83913 AIC19187
REF WP_007920550 WP_017337657 WP_045057924 WP_057444113