BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19540

Title: haddock model of MyT1 F4F5 - DNA complex   PubMed: 24097990

Authors: Gamsjaeger, Roland; O'Connell, Mitchell; Cubeddu, Liza; Shepherd, Nicholas; Lowry, Jason; Kwan, Ann; Vandevenne, Marylene; Swanton, Michael; Matthews, Jacqueline; Mackay, Joel

Citation: Gamsjaeger, Roland; Cubeddu, Mitchell; Shepherd, Liza; Lowry, Nicholas; Kwan, Jason; Vandevenne, Ann; Swanton, Marylene; Matthews, Michael; Mackay, Jacqueline. "A structural analysis of DNA binding by myelin transcription factor 1 double zinc fingers."  J. Biol. Chem. 288, 35180-35191 (2013).

Assembly members:
entity_1, polymer, 93 residues, 65.380 Da.
DNA_26_mer, polymer, 26 residues, Formula weight is not available
entity_ZN, non-polymer, 65.409 Da.

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
entity_1: GPLGSFDIKKELLTCPTPGC DGSGHITGNYASHRSLSGCP LADKSLRNLMAAHSADLKCP TPGCDGSGHITGNYASHRSL SGCPRAKKSGLRV
DNA_26_mer: ACCGAAAGTTCACGTGAACT TTCGGT

Data sets:
Data typeCount
13C chemical shifts115
15N chemical shifts51
1H chemical shifts51

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Myelin transcription factor 11
2DNA (26-MER)2
3ZINC ION_13
4ZINC ION_23

Entities:

Entity 1, Myelin transcription factor 1 93 residues - 65.380 Da.

1   GLYPROLEUGLYSERPHEASPILELYSLYS
2   GLULEULEUTHRCYSPROTHRPROGLYCYS
3   ASPGLYSERGLYHISILETHRGLYASNTYR
4   ALASERHISARGSERLEUSERGLYCYSPRO
5   LEUALAASPLYSSERLEUARGASNLEUMET
6   ALAALAHISSERALAASPLEULYSCYSPRO
7   THRPROGLYCYSASPGLYSERGLYHISILE
8   THRGLYASNTYRALASERHISARGSERLEU
9   SERGLYCYSPROARGALALYSLYSSERGLY
10   LEUARGVAL

Entity 2, DNA (26-MER) 26 residues - Formula weight is not available

1   DADCDCDGDADADADGDTDT
2   DCDADCDGDTDGDADADCDT
3   DTDTDCDGDGDT

Entity 3, ZINC ION_1 - Zn - 65.409 Da.

1   ZN

Samples:

sample_1: Myelin transcription factor 1, [U-13C; U-15N], 0.2 – 1.0 mM; DNA (26-MER)0.2 – 1.0 mM; phosphate 10 mM; NaCl 50 mM; DTT 1 mM

sample_conditions_1: ionic strength: 60 mM; pH: 7.2; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HN(CA)COsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

HADDOCK, Alexandre Bonvin - refinement

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz

Related Database Links:

PDB