BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19534

Title: Structural basis of the non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex   PubMed: 24828038

Authors: Duss, Olivier; Michel, Erich; Yulikov, Maxim; Schubert, Mario; Jeschke, Gunnar; Allain, Frederic

Citation: Duss, Olivier; Michel, Erich; Yulikov, Maxim; Schubert, Mario; Jeschke, Gunnar; Allain, Frederic H-T. "Structural basis of the non-coding RNA RsmZ acting as a protein sponge."  Nature 509, 588-592 (2014).

Assembly members:
RsmE, polymer, 59 residues, 6405.423 Da.
RNA_(72-MER), polymer, 72 residues, 23372.182 Da.

Natural source:   Common Name: Pseudomonas fluorescens   Taxonomy ID: 294   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Pseudomonas fluorescens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RsmE: MLILTRKVGESINIGDDITI TILGVSGQQVRIGINAPKDV AVHREEIYQRIQAGLTAPD
RNA_(72-MER): UGUCGACGGAUAGACACAGC CAUCAAGGACGAUGGUCAGG ACAUCGCAGGAAGCGAUUCA UCAGGACGAUGA

Data sets:
Data typeCount
13C chemical shifts125
15N chemical shifts21
1H chemical shifts146

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RsmE, 11
2RsmE, 21
3RsmE, 31
4RsmE, 41
5RsmE, 51
6RsmE, 61
7RNA (72-MER)2

Entities:

Entity 1, RsmE, 1 59 residues - 6405.423 Da.

1   METLEUILELEUTHRARGLYSVALGLYGLU
2   SERILEASNILEGLYASPASPILETHRILE
3   THRILELEUGLYVALSERGLYGLNGLNVAL
4   ARGILEGLYILEASNALAPROLYSASPVAL
5   ALAVALHISARGGLUGLUILETYRGLNARG
6   ILEGLNALAGLYLEUTHRALAPROASP

Entity 2, RNA (72-MER) 72 residues - 23372.182 Da.

1   UGUCGACGGA
2   UAGACACAGC
3   CAUCAAGGAC
4   GAUGGUCAGG
5   ACAUCGCAGG
6   AAGCGAUUCA
7   UCAGGACGAU
8   GA

Samples:

sample_1: RNA (72-MER), [U-13C; U-15N], segmentally labeled, 0.2 mM; RsmE, [U-100% 15N; U-80% 2H], 1.2 mM; sodium chloride 0.03 mM; potassium phosphate 0.05 mM

sample_2: RNA (72-MER), [U-13C; U-15N], segmentally labeled, 0.2 mM; RsmE, [U-100% 15N; U-80% 2H], 1.2 mM; sodium chloride 0.03 mM; potassium phosphate 0.05 mM

sample_3: RNA (72-MER), [U-13C; U-15N], segmentally labeled, 0.2 mM; RsmE, [U-100% 15N; U-80% 2H], 1.2 mM; sodium chloride 0.03 mM; potassium phosphate 0.05 mM

sample_4: RNA (72-MER), [U-13C; U-15N], segmentally labeled, 0.2 mM; RsmE, [U-100% 15N; U-80% 2H], 1.2 mM; sodium chloride 0.03 mM; potassium phosphate 0.05 mM

sample_5: RNA (72-MER), [U-13C; U-15N], segmentally labeled, 0.2 mM; RsmE, [U-100% 15N; U-80% 2H], 1.2 mM; sodium chloride 0.03 mM; potassium phosphate 0.05 mM

sample_6: RNA (72-MER) 0.2 mM; RsmE, [U-100% 15N; U-80% 2H], 1.2 mM; sodium chloride 0.03 mM; potassium phosphate 0.05 mM

sample_conditions_1: ionic strength: 0.18 M; pH: 7.2; pressure: 1 atm; temperature: 313 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-13C TROSYsample_1isotropicsample_conditions_1
2D 1H-13C TROSYsample_2isotropicsample_conditions_1
2D 1H-13C TROSYsample_3isotropicsample_conditions_1
2D 1H-13C TROSYsample_4isotropicsample_conditions_1
2D 1H-13C TROSYsample_5isotropicsample_conditions_1
2D 1H-15N HSQCsample_6isotropicsample_conditions_1

Software:

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

TOPSPIN, Bruker Biospin - processing

SPARKY, Goddard - data analysis

NMR spectrometers:

  • Bruker Avance 500 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 900 MHz

Related Database Links:

BMRB 15257 19544 19546 19547 19548 19549
PDB
DBJ BAO61455 BAQ73744 BAQ80031
EMBL CAY50674 CDF93721 CEL28723
GB AAT27429 AAY91370 ABA73655 ABW16953 AEA70068
REF WP_003179932 WP_003192511 WP_007905913 WP_007920550 WP_007938114