BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19448

Title: Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence   PubMed: 24088028

Authors: Williamson, Mike; Wilson, Tom; Thomas, James; Felix, Vitor; Costa, Paolo

Citation: Wilson, Tom; Costa, Paulo; Felix, Vitor; Williamson, Mike; Thomas, Jim. "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence."  J. Med. Chem. 56, 8674-8683 (2013).

Assembly members:
human_telomere_quadruplex, polymer, 22 residues, Formula weight is not available
entity_2FJ, non-polymer, 1211.268 Da.
entity_NA, non-polymer, 22.990 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
human_telomere_quadruplex: AGGGTTAGGGTTAGGGTTAG GG

Data sets:
Data typeCount
1H chemical shifts196

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1human telomere quadruplex1
2LL-(Ru[bipy]2)tppz4+, ligand2
3Na+, 13
4Na+, 23

Entities:

Entity 1, human telomere quadruplex 22 residues - Formula weight is not available

1   DADGDGDGDTDTDADGDGDG
2   DTDTDADGDGDGDTDTDADG
3   DGDG

Entity 2, LL-(Ru[bipy]2)tppz4+, ligand - C64 H44 N14 Ru2 - 1211.268 Da.

1   2FJ

Entity 3, Na+, 1 - Na - 22.990 Da.

1   NA

Samples:

sample_1: human telomere quadruplex 300 uM; LL-(Ru[bipy]2)tppz4+ 300 uM; sodium chloride 50 mM

sample_conditions_1: ionic strength: 50 mM; pH: 7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1
2D 1H-31P HSQCsample_1isotropicsample_conditions_1

Software:

X-PLOR NIH v2.14, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz

Related Database Links: