BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19402

Title: Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)   PubMed: 23999095

Authors: Lim, Kah Wai; Ng, Veronica Chinn Min; Martin-Pintado, Nerea; Heddi, Brahim; Phan, Anh Tuan

Citation: Lim, Kah Wai; Ng, Veronica Chinn Min; Martin-Pintado, Nerea; Heddi, Brahim; Phan, Anh Tuan. "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity."  Nucleic Acids Res. 41, 10556-10562 (2013).

Assembly members:
DNA_(27-MER), polymer, 27 residues, 8592.441 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(27-MER): TTAGGGTTAGGGTTAGGGTT AXGGTTA

Data sets:
Data typeCount
1H chemical shifts229

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA (27-MER)1

Entities:

Entity 1, DNA (27-MER) 27 residues - 8592.441 Da.

1   DTDTDADGDGDGDTDTDADG
2   DGDGDTDTDADGDGDGDTDT
3   DABGMDGDGDTDTDA

Samples:

sample_1: DNA (27-MER)1 – 2 mM; H2O 90%; D2O 10%

sample_2: DNA (27-MER)1 – 2 mM; D2O 100%

sample_3: DNA (27-MER), [U-2% 15N], 0.5 – 2 mM; H2O 90%; D2O 10%

sample_4: DNA (27-MER), [U-100% 2H], 0.2 – 1 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 100 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H JR NOESYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-13C JR HMBCsample_1isotropicsample_conditions_1
H-D EXCHANGEsample_1isotropicsample_conditions_1
15N-FILTEREDsample_3isotropicsample_conditions_1
D-LABELEDsample_4isotropicsample_conditions_1

Software:

TOPSPIN v2.1, Bruker Biospin - collection, processing

FELIX v2007, Felix NMR, Inc. - peak picking

X-PLOR NIH v2.29, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz

Related Database Links: