BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19400

Title: The structure of the Box CD enzyme reveals regulation of rRNA methylation   PubMed: 24121435

Authors: Lapinaite, Audrone; Simon, B.; Skjaerven, L.; Rakwalska-bange, M.; Gabel, F.; Carlomagno, T.

Citation: Lapinaite, Audrone; Simon, Bernd; Skjaerven, Lars; Rakwalska-Bange, Magdalena; Gabel, Frank; Carlomagno, Teresa. "The structure of the box C/D enzyme reveals regulation of RNA methylation."  Nature 502, 519-523 (2013).

Assembly members:
SSR26, polymer, 72 residues, 23589.23362 Da.
NOP5-NOP56_RELATED_PROTEIN, polymer, 366 residues, 42138.6332 Da.
50S_RIBOSOMAL_PROTEIN_L7AE, polymer, 121 residues, 13175.4847 Da.
FIBRILLARIN-LIKE_RRNA-TRNA_2'-O-METHYLTRANSFERASE, polymer, 227 residues, 25762.6891 Da.
5'-R(*UP*CP*GP*CP*CP*CP*AP*UP*CP*AP*CP)-3', polymer, 11 residues, 3466.08516 Da.

Natural source:   Common Name: Pyrococcus furiosus   Taxonomy ID: 2261   Superkingdom: Archaea   Kingdom: not available   Genus/species: Pyrococcus furiosus

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
SSR26: GCGAGCAAUGAUGAGUGAUG GGCGAACUGAGCUCGAAAGA GCAAUGAUGAGUGAUGGGCG AACUGAGCUCGC
NOP5-NOP56_RELATED_PROTEIN: FISENVRGIYAFDENGNLIE KRYFTDKPEKVLDQLLKGEI TKDLEELLNSLKEKGYDEFV FEHPCLSRRAKELGFSATTE FPNIAGERLRSNPCEFLGEN WFEEYYKVGVALTRMRIQEQ SGARDKMVIQAIEALDDVDK VINLLVARLREWYSLHFPEL DELLPKHPQYVAFVKTVGHR DNINEEVLRCLGLSECKIKK ILEAKEKTMGAWMDQTDIEV VRQLAEEIDRLYQLRKKLED YIDRAMCDVAPNLKALVGAK LAARLISLAGGLRELAMMPS STIQVLGAEKALFRHLRTGA KPPKHGVIYQYPAINRSPWW QRGKIARALAGKLAIAARVD YFCGEYIAEELKKELEARIR EIKEKY
50S_RIBOSOMAL_PROTEIN_L7AE: KPSYVKFEVPKCLAEKALQA VEIARDTGKIRKGTNETTKA VERGCAKLVIIAEDVDPEEI VAHLPPLCEECEIPYIYVPC KKELGAAACIEVAAASVAII EPGKARDLVEEIAMKVKELM K
FIBRILLARIN-LIKE_RRNA-TRNA_2'-O-METHYLTRANSFERASE: MVEVKKHKFPGVYVVIDDDG SEKIATKNLVPGQRVYGERV IKWEGEEYRIWNPHRSKLGA AIVNGLKNFPIKPGKSVLYL GIASGTTASHVSDIVGWEGK IYGIEFSPRVLRELVPIVEE RRNIIPILGDATKPEEYRAL VTKVDVIFEDVAQPTQAKIL IDNAKAYLKRGGYGMIAVKS RSIDVTKEPEQVFKEVEREL SEYFEVIERLNLEPYEKDHA LFVVRKP
5'-R(*UP*CP*GP*CP*CP*CP*AP*UP*CP*AP*CP)-3': UCGCCCAUCAC

Data sets:
Data typeCount
13C chemical shifts79
1H chemical shifts240

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all