BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19387

Title: Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative   PubMed: 23909929

Authors: Chung, Wan Jun; Heddi, Brahim; Tera, Masayuki; Iida, Keisuke; Nagasawa, Kazuo; Phan, Anh Tuan

Citation: Chung, Wan Jun; Heddi, Brahim; Tera, Masayuki; Iida, Keisuke; Nagasawa, Kazuo; Phan, Anh Tuan. "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative."  J. Am. Chem. Soc. 135, 13495-13501 (2013).

Assembly members:
DNA_(5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'), polymer, 24 residues, 7591.945 Da.
entity_L2H, non-polymer, 686.675 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'): TTGGGTTAGGGTTAGGGTTA GGGA

Data sets:
Data typeCount
1H chemical shifts240
31P chemical shifts23

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all