BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19278

Title: Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid   PubMed: 23794476

Authors: Lim, Kah Wai; Phan, Anh Tuan

Citation: Lim, Kah Wai; Phan, Anh Tuan. "Structural basis of DNA quadruplex-duplex junction formation."  Angew. Chem. Int. Ed. Engl. 52, 8566-8569 (2013).

Assembly members:
DNA_(32-MER), polymer, 32 residues, 10118.558 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(32-MER): GCGCGAAGCATTCGCGGGGA GGTGGGGAAGGG

Data sets:
Data typeCount
1H chemical shifts266

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA (32-MER)1

Entities:

Entity 1, DNA (32-MER) 32 residues - 10118.558 Da.

1   DGDCDGDCDGDADADGDCDA
2   DTDTDCDGDCDGDGDGDGDA
3   DGDGDTDGDGDGDGDADADG
4   DGDG

Samples:

DNA-1: DNA (32-MER) 0.5-2.0 mM; H2O 90%; D2O 10%

DNA-2: DNA (32-MER) 0.5-2.0 mM; D2O 100%

DNA-3: DNA (32-MER), [U-2% 15N], 0.5-2.0 mM; H2O 90%; D2O 10%

DNA-4: DNA (32-MER), [U-100% 2H], 0.5-2.0 mM; D2O 100%

sample_conditions_1: ionic strength: 40 mM; pH: 7; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 40 mM; pH: 7; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYDNA-2isotropicsample_conditions_1
2D 1H-1H JR NOESYDNA-1isotropicsample_conditions_1
2D 1H-1H JR NOESYDNA-1isotropicsample_conditions_2
2D 1H-1H COSYDNA-2isotropicsample_conditions_1
2D 1H-1H TOCSYDNA-2isotropicsample_conditions_1
2D 1H-13C HSQCDNA-2isotropicsample_conditions_1
2D 1H-13C JR HMBCDNA-1isotropicsample_conditions_1
2D 1H-31P HSQCDNA-2isotropicsample_conditions_1
H-D EXCHANGEDNA-2isotropicsample_conditions_1
15N-FILTEREDDNA-3isotropicsample_conditions_1
D-LABELEDDNA-4isotropicsample_conditions_1

Software:

TOPSPIN v2.1, Bruker Biospin - processing

FELIX v2007, Felix NMR, Inc. - peak picking

X-PLOR NIH v2.29, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 400 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz

Related Database Links: