BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19260

Title: A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo

Authors: Cash, Darian; Cohen, Osnat; Kim, Nak-Kyoon; Shefer, Kinneret; Brown, Yogev; Ulyanov, Nikolai; Tzfati, Yehuda; Feigon, Juli

Citation: Cash, Darian; Cohen, Osnat; Kim, Nak-Kyoon; Shefer, Kinneret; Brown, Yogev; Ulyanov, Nikolai; Tzfati, Yehuda; Feigon, Juli. "A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo"  Proc. Natl. Acad. Sci. U.S.A. ., .-..

Assembly members:
RNA_(48-MER), polymer, 48 residues, 15152.975 Da.

Natural source:   Common Name: ascomycetes   Taxonomy ID: 28985   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Kluyveromyces Lactis

Experimental source:   Production method: chemical synthesis   Host organism: in vitro

Entity Sequences (FASTA):
RNA_(48-MER): GGUUUCUUUUUAGUGAUUUU UCCAAACCCCUUUGUGCAAA AAUCAUUA

Data sets:
Data typeCount
13C chemical shifts247
15N chemical shifts32
1H chemical shifts339

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA_(48-MER)1

Entities:

Entity 1, RNA_(48-MER) 48 residues - 15152.975 Da.

1   GGUUUCUUUU
2   UAGUGAUUUU
3   UCCAAACCCC
4   UUUGUGCAAA
5   AAUCAUUA

Samples:

sample_1: RNA_(48-MER) 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; H2O 90%; D2O 10%

sample_2: RNA_(48-MER) 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; D2O 100%

sample_3: RNA_(48-MER), [U-98% 13C; U-98% 15N]-Ade,Uri, 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; H2O 90%; D2O 10%

sample_4: RNA_(48-MER), [U-98% 13C; U-98% 15N]-Ade,Uri, 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; D2O 100%

sample_5: RNA_(48-MER), [U-98% 13C; U-98% 15N]-Cyt,Gua, 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; H2O 90%; D2O 10%

sample_6: RNA_(48-MER), [U-98% 13C; U-98% 15N]-Cyt,Gua, 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; D2O 100%

sample_7: RNA_(48-MER), [U-98% 13C; U-98% 15N]-Ade,Uri,Cyt,Gua, 1 mM; TRIS 10 mM; Magnesium Chloride 0.5 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 10 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 10 mM; pH: 6.3; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 11echo NOESYsample_1isotropicsample_conditions_1
2D 13C Filtered/Edited NOESYsample_4isotropicsample_conditions_2
2D 13C Filtered/Edited NOESYsample_6isotropicsample_conditions_2
2D NOESY presatsample_2isotropicsample_conditions_2
2D HCCH-COSY, 3D HCCH-TOCSYsample_4isotropicsample_conditions_2
2D HCCH COSY, 3D HCCH-TOCSYsample_6isotropicsample_conditions_2
2D 1H-13C HSQCsample_4isotropicsample_conditions_2
2D 1H-13C HSQCsample_6isotropicsample_conditions_2
2D 1H-13C HSQCsample_7isotropicsample_conditions_2
2D HNNOESYsample_3isotropicsample_conditions_1
2D HNNOESYsample_5isotropicsample_conditions_1
HNN-COSYsample_3isotropicsample_conditions_1
HNN-COSYsample_5isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

Molmol, Koradi, Billeter and Wuthrich - data analysis, structure solution

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - chemical shift calculation, data analysis, peak picking

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

xwinnmr, Bruker Biospin - chemical shift assignment, data analysis, processing

TOPSPIN, Bruker Biospin - chemical shift assignment, data analysis, processing

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker DRX 600 MHz
  • Bruker DRX 500 MHz
  • Bruker DRX 500 MHz

Related Database Links: