BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19040

Title: structure of 2'-5' AG1 lariat forming ribozyme in its inactive state   PubMed: 23472843

Authors: Carlomagno, Teresa; Amata, Irene; Codutti, Luca; Falb, Melanie; Fohrer, Jorg; Simon, Bernd

Citation: Carlomagno, Teresa; Amata, Irene; Codutti, Luca; Falb, Melanie; Fohrer, Jorg; Simon, Bernd. "Structural principles of RNA catalysis in a 2'-5' lariat-forming ribozyme"  J. Am. Chem. Soc. 135, 4403-4411 (2013).

Assembly members:
RNA_(59-MER), polymer, 59 residues, 19163.486 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(59-MER): XGAAGAAAGGGCUUCGGCCA CUCAAACUACAGAGACGCCA GUCACUCAGAUAUCCUGGU

Data sets:
Data typeCount
13C chemical shifts347
15N chemical shifts12
1H chemical shifts430

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (59-MER)1

Entities:

Entity 1, RNA (59-MER) 59 residues - 19163.486 Da.

1   GTPGAAGAAAGG
2   GCUUCGGCCA
3   CUCAAACUAC
4   AGAGACGCCA
5   GUCACUCAGA
6   UAUCCUGGU

Samples:

sample_1: ADENOSINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 400 uM; D2O 100%

sample_2: GUANOSINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 300 uM; GUANOSINE-5'-TRIPHOSPHATE, [U-100% 13C; U-100% 15N], 300 uM; D2O 100%

sample_4: CYTIDINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 500 uM; D2O 100%

sample_3: URIDINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 300 uM; D2O 100%

sample_5: ADENOSINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 500 uM; URIDINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 500 uM; D2O 100%

sample_6: ADENOSINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 670 uM; URIDINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 670 uM; CYTIDINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 670 uM; GUANOSINE-5'-MONOPHOSPHATE, [U-100% 13C; U-100% 15N], 670 uM; D2O 100%

sample_7: ADENOSINE-5'-MONOPHOSPHATE 300 uM; URIDINE-5'-MONOPHOSPHATE 300 uM; CYTIDINE-5'-MONOPHOSPHATE 300 uM; GUANOSINE-5'-MONOPHOSPHATE 300 uM; D2O 100%

sample_conditions_1: ionic strength: 0.020 M; pH: 6.6; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQC ribosesample_1isotropicsample_conditions_1
2D 1H-13C HSQC basesample_1isotropicsample_conditions_1
2D HNN-COSYsample_6isotropicsample_conditions_1
2D imino NOESYsample_7isotropicsample_conditions_1
3D HsCNb/HbCNbsample_6isotropicsample_conditions_1
3D HCCH-COSY-TOCSYsample_1isotropicsample_conditions_1
3D 13C-edited/ 12C-filtered NOESYsample_1isotropicsample_conditions_1
3D 13C-edited/ 13C-filtered NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQC ribosesample_2isotropicsample_conditions_1
2D 1H-13C HSQC basesample_2isotropicsample_conditions_1
3D HCCH-COSY-TOCSYsample_2isotropicsample_conditions_1
3D 13C-edited/ 12C-filtered NOESYsample_2isotropicsample_conditions_1
3D 13C-edited/ 13C-filtered NOESYsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-13C HSQC ribosesample_3isotropicsample_conditions_1
2D 1H-13C HSQC basesample_3isotropicsample_conditions_1
3D HCCH-COSY-TOCSYsample_3isotropicsample_conditions_1
3D 13C-edited/ 12C-filtered NOESYsample_3isotropicsample_conditions_1
3D 13C-edited/ 13C-filtered NOESYsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_4isotropicsample_conditions_1
2D 1H-13C HSQC ribosesample_4isotropicsample_conditions_1
2D 1H-13C HSQC basesample_4isotropicsample_conditions_1
3D HCCH-COSY-TOCSYsample_4isotropicsample_conditions_1
3D 13C-edited/ 12C-filtered NOESYsample_4isotropicsample_conditions_1
3D 13C-edited/ 13C-filtered NOESYsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-13C HSQC ribosesample_5isotropicsample_conditions_1
2D 1H-13C HSQC basesample_5isotropicsample_conditions_1
3D HCCH-COSY-TOCSYsample_5isotropicsample_conditions_1
3D 13C-edited/ 12C-filtered NOESYsample_5isotropicsample_conditions_1
3D 13C-edited/ 13C-filtered NOESYsample_5isotropicsample_conditions_1

Software:

FELIX, Accelrys Software Inc. - chemical shift assignment

ARIA, Linge, O, . - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker Avance 900 MHz

Related Database Links: