BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19039

Title: NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8

Authors: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.

Citation: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.. "Acid-base equilibria near neutral pH in the catalytic triad and the bulge of domain 5 of a bacterial group II intron"  Not known ., .-..

Assembly members:
RNA_(35-MER), polymer, 35 residues, 11268.784 Da.

Natural source:   Common Name: Azotobacter vinelandii   Taxonomy ID: 354   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Azotobacter vinelandii

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
RNA_(35-MER): GGAGCCGUAUGCGGUAGUUC CGCACGUACGGAUCU

Data typeCount
13C chemical shifts216
15N chemical shifts95
1H chemical shifts569

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (35-MER)1

Entities:

Entity 1, RNA (35-MER) 35 residues - 11268.784 Da.

The sequence corresponds to residues 1836 to 1870 from group II intron 5 of A. vinelandii (numbering includes the open reading frame).

1   GGAGCCGUAU
2   GCGGUAGUUC
3   CGCACGUACG
4   GAUCU

Samples:

AvD5_wt_d2o: RNA (35-MER)0.5 – 1 mM; potassium chloride 60 mM; EDTA 10 uM

AvD5_wt_h2o: RNA (35-MER)0.5 – 1 mM; potassium chloride 60 mM; EDTA 10 uM

AvD5_lab_d2o: RNA (35-MER), [100% 13C; 100% 15N], 0.5 – 1 mM; potassium chloride 60 mM; EDTA 10 uM

AvD5_lab_h2o: RNA (35-MER), [100% 13C; 100% 15N], 0.5 – 1 mM; potassium chloride 60 mM; EDTA 10 uM

AvD5_deut_d2o: RNA (35-MER), [3, 0.5; 5, 2, ; 5, 3, ; 5

300K_d2o_pH7.8: ionic strength: 60 mM; pD: 7.8; pressure: 1 atm; temperature: 300 K

275K_h2o_pH7.8: ionic strength: 60 mM; pH: 7.8; pressure: 1 atm; temperature: 275 K

300K_d2o_pH5.2: ionic strength: 60 mM; pD: 5.2; pressure: 1 atm; temperature: 300 K

300K_d2o_pH6.7: ionic strength: 60 mM; pD: 6.7; pressure: 1 atm; temperature: 300 K

275K_h2o_pH5.2: ionic strength: 60 mM; pH: 5.2; pressure: 1 atm; temperature: 275 K

275K_h2o_pH6.7: ionic strength: 60 mM; pH: 6.7; pressure: 1 atm; temperature: 275 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYAvD5_wt_d2oisotropic300K_d2o_pH7.8
2D 1H-1H NOESYAvD5_deut_d2oisotropic300K_d2o_pH7.8
2D 1H-1H NOESYAvD5_wt_h2oisotropic275K_h2o_pH7.8
2D 1H-1H TOCSYAvD5_wt_d2oisotropic300K_d2o_pH7.8
2D 1H-15N HSQCAvD5_lab_h2oisotropic275K_h2o_pH7.8
2D 1H-13C HSQC aromaticAvD5_lab_d2oisotropic300K_d2o_pH7.8
2D 1H-13C HSQC aliphaticAvD5_lab_d2oisotropic300K_d2o_pH7.8
2D JNN HNN COSYAvD5_lab_h2oisotropic275K_h2o_pH7.8
2D 1H-1H NOESYAvD5_wt_d2oisotropic300K_d2o_pH5.2
2D 1H-1H NOESYAvD5_wt_d2oisotropic300K_d2o_pH6.7
2D 1H-1H NOESYAvD5_wt_h2oisotropic275K_h2o_pH5.2
2D 1H-1H NOESYAvD5_wt_h2oisotropic275K_h2o_pH6.7
2D 1H-13C HSQC aromaticAvD5_lab_d2oisotropic300K_d2o_pH5.2
2D 1H-13C HSQC aromaticAvD5_lab_d2oisotropic300K_d2o_pH6.7
2D 1H-13C HSQC aliphaticAvD5_lab_d2oisotropic300K_d2o_pH6.7
2D 1H-15N HSQCAvD5_lab_h2oisotropic275K_h2o_pH5.2
2D 1H-15N HSQCAvD5_lab_h2oisotropic275K_h2o_pH6.7
2D JNN HNN COSYAvD5_lab_h2oisotropic275K_h2o_pH5.2
2D JNN HNN COSYAvD5_lab_h2oisotropic275K_h2o_pH6.7

Software:

CNS v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution

X-PLOR NIH v2.3, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

Molmol, Koradi, Billeter and Wuthrich - data analysis

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

TOPSPIN v3.0.a, Bruker Biospin - data analysis, processing

CURVES, Lavery - data analysis

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz

Related Database Links: