BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18935

Title: African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA   PubMed: 24617852

Authors: Wu, Wen-Jin; Su, Mei-I; Tsai, Ming-Daw

Citation: Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank; Chen, Ming-Chuan Chad; Doreleijers, Jurgen; Wijmenga, Sybren; Tsai, Ming-Daw. "How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation."  J. Am. Chem. Soc. 136, 4927-4937 (2014).

Assembly members:
entity, polymer, 174 residues, 20351.670 Da.
entity_MG, non-polymer, 24.305 Da.
entity_DGT, non-polymer, 507.181 Da.
DNA, polymer, . residues, Formula weight is not available

Natural source:   Common Name: African Swine Fever Virus   Taxonomy ID: 10497   Superkingdom: Viruses   Kingdom: not available   Genus/species: Asfivirus African Swine Fever Virus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
entity: MLTLIQGKKIVNHLRSRLAF EYNGQLIKILSKNIVAVGSL RREEKMLNDVDLLIIVPEKK LLKHVLPNIRIKGLSFSVKV CGERKCVLFIEWEKKTYQLD LFTALAEEKPYAIFHFTGPV SYLIRIRAALKKKNYKLNQY GLFKNQTLVPLKITTEKELI KELGFTYRIPKKRL
DNA: GGCGAAGCCGGGTGCGAAGC ACC

Data sets:
Data typeCount
13C chemical shifts571
15N chemical shifts165
1H chemical shifts476

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1African Swine Fever Virus Pol X1
22'-DEOXYGUANOSINE-5'-TRIPHOSPHATE3
3MG2_12
4MG2_22
5DNA4

Entities:

Entity 1, African Swine Fever Virus Pol X 174 residues - 20351.670 Da.

1   METLEUTHRLEUILEGLNGLYLYSLYSILE
2   VALASNHISLEUARGSERARGLEUALAPHE
3   GLUTYRASNGLYGLNLEUILELYSILELEU
4   SERLYSASNILEVALALAVALGLYSERLEU
5   ARGARGGLUGLULYSMETLEUASNASPVAL
6   ASPLEULEUILEILEVALPROGLULYSLYS
7   LEULEULYSHISVALLEUPROASNILEARG
8   ILELYSGLYLEUSERPHESERVALLYSVAL
9   CYSGLYGLUARGLYSCYSVALLEUPHEILE
10   GLUTRPGLULYSLYSTHRTYRGLNLEUASP
11   LEUPHETHRALALEUALAGLUGLULYSPRO
12   TYRALAILEPHEHISPHETHRGLYPROVAL
13   SERTYRLEUILEARGILEARGALAALALEU
14   LYSLYSLYSASNTYRLYSLEUASNGLNTYR
15   GLYLEUPHELYSASNGLNTHRLEUVALPRO
16   LEULYSILETHRTHRGLULYSGLULEUILE
17   LYSGLULEUGLYPHETHRTYRARGILEPRO
18   LYSLYSARGLEU

Entity 3, 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE - C10 H16 N5 O13 P3 - 507.181 Da.

1   DGT

Entity 2, MG2_1 - Mg - 24.305 Da.

1   MG

Entity 4, DNA - Formula weight is not available

1   DGDGDCDGDADADGDCDCDG
2   DGDGDTDGDCDGDADADGDC
3   DADCDC

Samples:

sample_1: African Swine Fever Virus Pol X, ILV-CH3-[U-13C; U-15N; U-2H], 0.5 mM; Mg 10 mM; dGTP 4 mM; DNA, [U-100% 13C; U-100% 15N], 0.6 mM; Borate 50 mM; DTT, [U-2H], 10 mM; potassium chloride 200 mM

sample_conditions_1: ionic strength: 250 mM; pH: 6.5; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HNCAsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
3D HN(CO)CAsample_1isotropicsample_conditions_1
3D HMCMCGCBCAsample_1isotropicsample_conditions_1
3D HN(CO)CACBsample_1isotropicsample_conditions_1

Software:

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

HADDOCK, Dr. Alexandre Bonvin - refinement

NMR spectrometers:

  • Bruker Avance 850 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 600 MHz

Related Database Links:

BMRB 18933 18934
PDB
EMBL CAN10196 CAN10446 CBH29197
GB AAA65326 AIY22288 AIY22446 AKO62778
PRF 2113434DC
REF NP_042790
SP P0C984 P42494